ID: 1019281077

View in Genome Browser
Species Human (GRCh38)
Location 7:200524-200546
Sequence CTGCTGTCTCTGCTCAGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019281077_1019281079 -8 Left 1019281077 7:200524-200546 CCCGTGCTGAGCAGAGACAGCAG 0: 1
1: 0
2: 3
3: 34
4: 322
Right 1019281079 7:200539-200561 GACAGCAGCCCCCTAGCTGCAGG 0: 1
1: 0
2: 2
3: 23
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019281077 Original CRISPR CTGCTGTCTCTGCTCAGCAC GGG (reversed) Intronic
900215319 1:1478561-1478583 CTCCTGTGTCTGCACAGCTCCGG - Intronic
900560471 1:3303339-3303361 CTGGCTTCTCTGCTCAGCATAGG + Intronic
900591232 1:3460927-3460949 CCTCTGTCCCTGCTCAGCCCCGG - Intronic
900819824 1:4878086-4878108 CTTCTCTCTCTGCTCAGCCTGGG + Intergenic
900911225 1:5598328-5598350 CAGACGTCTCTGCACAGCACAGG + Intergenic
901060074 1:6467893-6467915 CAGGGGTCTCTGCCCAGCACAGG - Exonic
901139424 1:7018874-7018896 CTGTTATCTCTGATCAGCAGCGG + Intronic
901727219 1:11251212-11251234 CTGCTCACTCTGCTCAGCCATGG + Intronic
901802113 1:11714361-11714383 CAGCCATTTCTGCTCAGCACGGG - Intronic
903649631 1:24914739-24914761 CAGCTGCCTCTCCTCAGCCCAGG + Intronic
904279462 1:29408842-29408864 CTGCTGTTTCTGTTCAGCTGTGG - Intergenic
905394485 1:37658156-37658178 TTGCTGTTCCTCCTCAGCACTGG - Intergenic
905532562 1:38693722-38693744 CTGCTGTGTGTACTCAGTACAGG + Intergenic
906567952 1:46813898-46813920 CTGCTGTCCCTGCTAAGCAGAGG - Exonic
906667903 1:47634490-47634512 CTGCTGTCTCTCCTTGGCTCTGG - Intergenic
907786392 1:57617205-57617227 CTGGTGGCTCTCCTCAGCAGAGG - Intronic
907840749 1:58155062-58155084 CTGGTGTCTCAGCTCAGAAGAGG + Intronic
908903198 1:68979722-68979744 CTATTGTCTCTTCTCATCACTGG + Intergenic
909248854 1:73326870-73326892 CTGGTGCCTGTGCTCATCACTGG - Intergenic
909836543 1:80261381-80261403 CTGATCTCCCTGCTCAGCCCTGG - Intergenic
910116336 1:83736373-83736395 CTTCTGTCACTGCTCTGCAGGGG - Intergenic
910672150 1:89784267-89784289 CTGCAGTCTCTGCTCAACATGGG - Intronic
911687074 1:100789901-100789923 CTGCAGCCTCTACTCAGCTCTGG - Intergenic
912586034 1:110766776-110766798 ATGCTGTCTCAACTCAGCCCAGG + Intergenic
912694080 1:111827832-111827854 CTTCTTCCTCTGCTCAGCCCTGG - Intronic
913961323 1:143339912-143339934 CTGCTGCCTCTGCACAGCCGTGG - Intergenic
914055676 1:144165485-144165507 CTGCTGCCTCTGCACAGCCGTGG - Intergenic
914123470 1:144800877-144800899 CTGCTGCCTCTGCACAGCCGTGG + Intergenic
914878541 1:151530135-151530157 CAGCCCTCTCTGCTCAGCCCTGG + Intronic
914920196 1:151841340-151841362 CTTCTGACTCAGCTCAGCCCTGG + Intergenic
915043615 1:152991415-152991437 CTGCGGTATCTGCCTAGCACAGG - Intergenic
915141486 1:153771136-153771158 CAGCTGGCTCTGCTCTGCACAGG - Intronic
915489587 1:156243760-156243782 TGGAAGTCTCTGCTCAGCACAGG - Exonic
915724985 1:158011098-158011120 CTGCTCACTCTTCTCAGCCCAGG + Intronic
916252726 1:162754521-162754543 CTGCTCTCTCCCCTCAGTACAGG + Intronic
917035883 1:170746412-170746434 CTGCTGTCCTTGCTCCCCACGGG - Intergenic
917538575 1:175892254-175892276 CTTCTGTCTCTGCCCAGCAGTGG - Intergenic
917737260 1:177932591-177932613 CTGTTTCCTCTGCTCAGGACTGG + Intronic
920053537 1:203177495-203177517 CTGCTGTCTCTGCTGGGGAGTGG + Intergenic
920093648 1:203471903-203471925 ATGCTGTCTCTGCCCAGCAGGGG + Intergenic
920557778 1:206916563-206916585 CTGCTGGCTATGCTGAGCTCTGG + Intronic
920631640 1:207658794-207658816 TTGCTGTCTCACCTCAGCACTGG + Intronic
921951959 1:220939399-220939421 CTGCTGTCTCTCCTCTCCATTGG + Intergenic
922376866 1:224977688-224977710 ATGCTGTATCTGCGCAGCAAAGG + Intronic
922463366 1:225829494-225829516 CTGCTGCCCCTCCTCTGCACAGG + Intronic
924052534 1:240092819-240092841 CTGCCGTCTCCCCTCAGCCCGGG + Exonic
924580566 1:245320208-245320230 CTGCTGCCTCTGCACTGAACAGG - Intronic
1063324995 10:5090250-5090272 CTGGTGCCTGTGCTCATCACTGG - Intronic
1067569079 10:47358693-47358715 CTGCTGTCCCTGCTAAGCACAGG - Intergenic
1070055173 10:72927490-72927512 CTTCTGTATGTGCTAAGCACTGG - Intronic
1070696048 10:78563886-78563908 CTGCTCCCTCTGCCCAGTACTGG + Intergenic
1071400056 10:85260112-85260134 CTTCTCTCTCTTATCAGCACTGG - Intergenic
1071529361 10:86377218-86377240 CCGCTGTCTCTGTTCAGCCCGGG - Intergenic
1071954534 10:90743461-90743483 CCACTGTCTCTTCCCAGCACAGG + Intronic
1073452680 10:103618929-103618951 CTGCTATCTCGGCTCAGCACAGG - Intronic
1074285381 10:112092886-112092908 CTCCTGCCTCTCCTTAGCACTGG - Intergenic
1074969846 10:118527168-118527190 CTGGTGGCCATGCTCAGCACAGG - Intergenic
1075204289 10:120433465-120433487 CTGCTCTGTTTGCTGAGCACAGG + Intergenic
1075801775 10:125159194-125159216 CGGCTGTCCCTGCGCCGCACCGG + Intronic
1076098737 10:127756555-127756577 ATTCTGTCTCTACTGAGCACAGG - Intergenic
1076284171 10:129277218-129277240 CTGCATCCTCTTCTCAGCACTGG - Intergenic
1076479067 10:130772497-130772519 CTGCTGTGTGGGCTGAGCACAGG - Intergenic
1077076655 11:705359-705381 CTGCTGTGACCGCTCAGAACAGG - Intronic
1077432552 11:2523005-2523027 CAGCTGTGTCTCCTGAGCACAGG + Intronic
1077463046 11:2720518-2720540 CTGCTTGCTCTGGTCAGCCCTGG - Intronic
1078740529 11:14062218-14062240 CTGCTGACCCTGCCCAGCAAGGG - Intronic
1079091802 11:17485985-17486007 CTGCTGTGTGTGCCCAGAACAGG + Intergenic
1080139099 11:28893178-28893200 ATGATGTCTCTTCTCAACACAGG - Intergenic
1080845073 11:36019863-36019885 CCTCTGTTTCTGCTCTGCACTGG - Intronic
1081783008 11:45726513-45726535 CATCTGTCTCTGCTCAGGGCAGG - Intergenic
1082188276 11:49210207-49210229 CTACAGTCTCTATTCAGCACAGG + Intergenic
1084738396 11:71121008-71121030 ATGCTGTGTCTGTGCAGCACGGG + Intronic
1086678240 11:89636436-89636458 CTACAGTCTCTATTCAGCACAGG - Intergenic
1087138982 11:94747317-94747339 GTGCTGTCTCTGCTCAGACCTGG + Intronic
1088750047 11:112835706-112835728 CAGCTGCCTCTGAGCAGCACTGG + Intergenic
1089050292 11:115539753-115539775 CTGCTGGCTCAGCTCTGCACAGG + Intergenic
1089301507 11:117501778-117501800 CTGCTGTCTCTCCACACCTCGGG - Intronic
1089378189 11:118009957-118009979 GTGCAGACTCTGCTCAGCTCTGG + Intergenic
1089572107 11:119417812-119417834 CTGCTTTTTCTTCTCAGCTCTGG - Exonic
1089863699 11:121613201-121613223 CTGCTGTCTCTCATTAGCAACGG - Intronic
1090635772 11:128689762-128689784 CTGCTCTCTCTGGTCAGGATTGG + Intronic
1090743906 11:129691883-129691905 GTGCTGGCTCTGCTCAGCACTGG - Intergenic
1090984136 11:131750878-131750900 CTGCTCTCTCTCCTCACCACAGG + Intronic
1091918919 12:4289021-4289043 CAGATGTCTCTTCTCAGCTCAGG + Intronic
1092149751 12:6239483-6239505 CTGCTGGCTCACCTCAGCAGAGG - Intergenic
1096814899 12:54195853-54195875 CTGCTGCGCCTGCTCAGCTCAGG - Intergenic
1099541322 12:83911744-83911766 CTGATGTATCTGCTCATCTCTGG - Intergenic
1099945889 12:89243991-89244013 CTGCTCTCTCTGCCCAGAAAAGG + Intergenic
1102472667 12:113168299-113168321 CTGCGCTCTCTGCTGACCACTGG + Intronic
1102560101 12:113755802-113755824 CTGTTGTCTAGGCTTAGCACAGG + Intergenic
1102583607 12:113908006-113908028 CAGGTGTCTCTCCTCTGCACAGG - Intronic
1103945184 12:124522176-124522198 CTACTGTATGTGCTGAGCACTGG + Intronic
1103960164 12:124604322-124604344 CTGCTGTCTCCACTCTGAACTGG + Intergenic
1104074494 12:125377253-125377275 CTGCTGTCTCAGCCCAGCTCTGG - Intronic
1104347261 12:128011826-128011848 CTCCTGTGTTTGCTCAGCAAGGG + Intergenic
1104899889 12:132183204-132183226 ATGCTCTCTCAGCCCAGCACTGG - Intergenic
1105925586 13:25004674-25004696 CTATGGTCTCTGCTCAGCACTGG + Intergenic
1106039116 13:26072986-26073008 CTATGGTCTCTGCTCAGCACTGG - Intergenic
1110128642 13:71979157-71979179 CTGATCTCACTGCTCAGCCCTGG - Intergenic
1110789605 13:79573245-79573267 TTGCAGTTTGTGCTCAGCACAGG - Intergenic
1110925656 13:81148094-81148116 ATGCTGTATCTACTCAGTACAGG + Intergenic
1111183069 13:84694122-84694144 CTGCCCTGTCTGCCCAGCACTGG - Intergenic
1111729352 13:92053366-92053388 CTGCTGTTTCTAGTCAGCAGAGG + Intronic
1112277187 13:98032319-98032341 CTGCTGGCTCAGCACAGCACAGG - Intergenic
1112525965 13:100147382-100147404 CAGCTATCACTGCTCAACACAGG - Intronic
1113013622 13:105800506-105800528 ATACTGTATCTGCTCATCACAGG + Intergenic
1113727894 13:112618680-112618702 TTGCTGTCTCTGCGCAGCTTGGG - Intergenic
1113912867 13:113852578-113852600 CTGCTGCCTTTGCTCTGCTCAGG + Intronic
1113968226 13:114166839-114166861 CTGCTCCCTCTCCTCACCACGGG + Intergenic
1114699673 14:24664289-24664311 CTGCTCTCAGTCCTCAGCACAGG - Intergenic
1115163755 14:30424825-30424847 CTGCTGTCTGTTCTCAACATCGG - Intergenic
1116934437 14:50724613-50724635 CTTCTTTCTTGGCTCAGCACTGG + Intronic
1118636231 14:67751096-67751118 GTGCTGTTTCTGTTCTGCACAGG - Exonic
1119414009 14:74457383-74457405 CTGCTGTTTCTCCTCAGTGCAGG - Intergenic
1120121114 14:80680899-80680921 CTGAGCTCTCTGCTCAGCACTGG - Intronic
1121102136 14:91257002-91257024 CTGCTGTCTCTGCCAAGGACTGG - Intergenic
1121406212 14:93720769-93720791 CTCCTGTGTCTGCTCAGGAGGGG + Exonic
1121452478 14:94017915-94017937 CTGCTGTCTCTGCCTAGGGCCGG - Intergenic
1122020984 14:98837679-98837701 CTGCCGCCTCTGTCCAGCACTGG - Intergenic
1122199819 14:100115621-100115643 GAGCTGTCTCTGCTAAGCCCAGG + Intronic
1122387859 14:101361240-101361262 CGGCTGCCTCTGCTCTGCTCTGG - Intergenic
1122857430 14:104566550-104566572 TTGCTGTCTCGGCTCTGCAGAGG + Intronic
1123683565 15:22781592-22781614 CTGCTGTCTTTGCTCATTCCTGG + Intronic
1123990290 15:25678342-25678364 TTGCTGGCTCTGCTCGGCACCGG - Exonic
1124335767 15:28855962-28855984 CTGCTGTCTTTGCTCATTCCTGG + Intergenic
1124856490 15:33394245-33394267 CTACTGTCTCAGCTCATCATAGG - Intronic
1126360199 15:47837834-47837856 TTCCTGTCTCTGCTCAGGAGTGG + Intergenic
1127724613 15:61736979-61737001 TTTCTGTCTCTGCTCAAAACAGG + Intergenic
1129618131 15:77116321-77116343 CTGCTCTCCCTCCTCAGCAGAGG + Intronic
1130146375 15:81276872-81276894 CTGCTGACTCTCCTCAACAGTGG - Intronic
1130906860 15:88246851-88246873 CTGACCTCTCTGCTCAGCCCTGG + Intronic
1131404528 15:92153722-92153744 GTGATGTCTATGCTCAGCCCTGG + Intronic
1132573363 16:653659-653681 CTGCTCTCTCAGGTGAGCACAGG + Exonic
1132720889 16:1315104-1315126 CTGCTGGGACTGCTCAGCTCAGG - Intronic
1132808339 16:1786108-1786130 CTGCTGCCTCTGCCGAGCCCAGG + Intronic
1132855427 16:2042713-2042735 CTGGTGTCTCTTCCTAGCACCGG - Intronic
1136519352 16:30786319-30786341 CTGCTGTGTTTGCTCGGGACAGG + Intronic
1136610319 16:31362036-31362058 CTCCGGCCTCTGCTCAGCCCTGG + Intronic
1137693489 16:50446033-50446055 GTGCGGTCTGTGCCCAGCACTGG + Intergenic
1141163624 16:81645684-81645706 CTGCTGTCTCTGCTTGCCGCTGG + Intronic
1141746838 16:85931666-85931688 CAGCTGTGCCTGCTCAGCCCGGG + Intergenic
1141764786 16:86051355-86051377 CATCTGCCTCTGCTCAGCAGAGG - Intergenic
1142668445 17:1475593-1475615 CTGCGGGCTCTGCTCAGAAGGGG + Intronic
1143649400 17:8254178-8254200 CTTCTTTGTCTCCTCAGCACTGG - Exonic
1143706063 17:8698429-8698451 CCGCTTTCTCTCCTCAGCCCGGG - Intergenic
1143972522 17:10805804-10805826 CTGCTGTGTCTGCACAGGGCTGG + Intergenic
1144044608 17:11443891-11443913 CTGATGTCTCTGGTCAGAGCTGG + Intronic
1146133590 17:30298511-30298533 CTGCTGGCTTTGCTCATCTCAGG - Intergenic
1146728004 17:35171178-35171200 CTGCTGTCTTTCCTCAGAATGGG + Intronic
1148101938 17:45097478-45097500 CTGGTGTGCCTGCTCAGCAGAGG + Intronic
1148102880 17:45103413-45103435 CTCCTATGTCTGGTCAGCACTGG - Intronic
1149222014 17:54425928-54425950 CTCCTGTTTCACCTCAGCACAGG - Intergenic
1149609130 17:57946892-57946914 TTCCTCTCTCTGCTCAACACAGG + Intronic
1151232382 17:72694191-72694213 ATGCTGGCTCTGCTGAGCATGGG + Intronic
1151517669 17:74606720-74606742 CAGCTGGCTCTGCACAGCACAGG + Intergenic
1152110291 17:78353896-78353918 CAGATGACTCTGCTCAGCACCGG - Intergenic
1152660305 17:81539021-81539043 CTGCTGTCTGTGCAGAGCAGTGG - Intergenic
1153030031 18:705001-705023 CTGCTGTTACTGCTCTTCACAGG - Intronic
1153773323 18:8432773-8432795 CAGCAGCCTCTGCTCAGCCCTGG + Intergenic
1154228564 18:12531861-12531883 CTGCCCCCTCTGCACAGCACAGG + Intronic
1154506884 18:15049788-15049810 CTGATGCCTCTGTTGAGCACTGG - Intergenic
1157426369 18:47587757-47587779 CTGCTTTCTCTGCTCCATACTGG + Intergenic
1158110252 18:53932751-53932773 CTAATGTCACTGCTGAGCACTGG - Intergenic
1158441528 18:57479002-57479024 CAGTTCTCTCTGCTCAGCAGAGG + Exonic
1158448563 18:57542830-57542852 CTTCTGTCCCTGCTCAGAGCTGG - Intergenic
1158587713 18:58755982-58756004 CTCCTGCCTCTCCTCAGCAGGGG - Intergenic
1159793080 18:72808370-72808392 ATGCTGTCTCTGCTACACACAGG + Intronic
1159903574 18:74070194-74070216 TTGCTGACGCTGCTAAGCACTGG + Intergenic
1160068345 18:75600007-75600029 CTCCTGTGTGTGCTCAGCTCAGG - Intergenic
1160508544 18:79440732-79440754 CTGCTGTGTCTGAACAGCTCCGG + Intronic
1160720917 19:596620-596642 GGCCTGTCCCTGCTCAGCACTGG + Intronic
1160869965 19:1273232-1273254 CTTCTCTCTCTGCTCAGGTCTGG - Intronic
1161582524 19:5088590-5088612 CGGTGGTCTCTGCTCAGCCCTGG - Intronic
1161851117 19:6738643-6738665 CTGATGTCTCTGCTGAGACCTGG - Intronic
1163429829 19:17260689-17260711 CTGCTGTCTCCTCTGAGCCCTGG + Intronic
1163623510 19:18374628-18374650 CCGCTTTCCCTGCTGAGCACGGG + Intergenic
1164751281 19:30656813-30656835 CTGATGTTTCTGCTCTGCACGGG + Intronic
1166393791 19:42424485-42424507 CAGCTTTCTATCCTCAGCACTGG + Intronic
1166662251 19:44654558-44654580 CTGCTGACTGTGCACAGCATGGG - Intronic
1167608861 19:50496635-50496657 CTGCTTTCTCTGCTCTGCCTGGG - Intergenic
1168423850 19:56223124-56223146 GTGGGGTCTCTGCTCTGCACAGG - Intronic
1168645669 19:58057539-58057561 CTGCTGTCTCTTGTAACCACTGG - Intergenic
1202695159 1_KI270712v1_random:118162-118184 CTGCTGCCTCTGCACAGCCGTGG - Intergenic
925339494 2:3126308-3126330 CTGCTGCCTCTTCTCAACAAGGG + Intergenic
925970455 2:9103269-9103291 TGGTTCTCTCTGCTCAGCACTGG - Intergenic
927277607 2:21274920-21274942 ATGCTGGCTCTGCCCAGAACTGG + Intergenic
928431168 2:31219431-31219453 CTTCTGTCTCTGCAAGGCACAGG + Intronic
928693310 2:33823175-33823197 CTGTGGGCTCTGTTCAGCACAGG + Intergenic
929051140 2:37838093-37838115 CTGCTGAATGTGCTCTGCACAGG + Intergenic
929258295 2:39838227-39838249 CTGGTGCCTGTGCTCATCACTGG - Intergenic
929661492 2:43789909-43789931 CAGCTATCTCAGTTCAGCACGGG - Intronic
931463576 2:62468249-62468271 CTTCTCTCTTTGCTCAGCCCTGG - Intergenic
932337603 2:70939832-70939854 CGGCTGTTTCTGTTCAGCATTGG - Exonic
933014311 2:77104833-77104855 CTGCAGTTTCTGCTCAGTATGGG - Intronic
934276329 2:91575211-91575233 CTGCTGCCTCTGCACAGCCGTGG - Intergenic
934902596 2:98172452-98172474 CTTCTGTCTCTGCACAGAATGGG + Intronic
936471825 2:112805636-112805658 CAGCTGTCTCTGCTCAGCCATGG - Intergenic
936608064 2:113977180-113977202 CAGCTGTCTCTGCTCTGGGCTGG + Intergenic
938187112 2:129241189-129241211 CTGCTGCCTCTGCAAGGCACAGG + Intergenic
938376063 2:130807634-130807656 CTGCCTTCTCTGCTGAGGACAGG + Intergenic
939083710 2:137691954-137691976 GTTCTCTCTCTGCTCAGCTCTGG - Intergenic
940184375 2:150967126-150967148 CAGCTTTCTTTTCTCAGCACAGG + Intergenic
941274310 2:163471439-163471461 CTGCTCTCTTTCTTCAGCACTGG + Intergenic
941512351 2:166427795-166427817 CTTGTTACTCTGCTCAGCACTGG - Exonic
942044003 2:172088451-172088473 CTGCTGCCACTGCTCGGCCCAGG - Exonic
942423773 2:175837588-175837610 CTGCTGTCTCTTCTAGGCAAAGG - Intergenic
942937348 2:181574356-181574378 CTGCTTCCTCTGTTCTGCACTGG - Intronic
947833391 2:233158077-233158099 ACGCTGTCTCTGCTCTGGACAGG + Intronic
948006170 2:234609583-234609605 CAGCTGTCTCTGCGCACCAATGG + Intergenic
948099750 2:235364493-235364515 CTGCTGTCTCTTTTTAGCAGGGG + Intergenic
948583003 2:239000649-239000671 TTGGTGTTTCTGCGCAGCACAGG + Intergenic
948704702 2:239781631-239781653 CTGCTGCCCCTGCTGGGCACTGG + Intronic
948798992 2:240421677-240421699 ATGCTGTCTCTGCCTTGCACTGG - Intergenic
1168760504 20:347112-347134 CTGCTGTCTCCGCCGAGCAAAGG - Exonic
1169388964 20:5173966-5173988 CAGCTGACACTGCACAGCACAGG + Intronic
1172304419 20:33871137-33871159 CTGCTGCCTCAGCACAGCCCTGG + Intergenic
1172481541 20:35274687-35274709 CTGCTGGCCCTGGTGAGCACTGG - Exonic
1172744094 20:37193375-37193397 CTGCTCTCTATCCTCCGCACAGG - Intronic
1173382065 20:42554477-42554499 CTGTCCTCACTGCTCAGCACAGG + Intronic
1173643794 20:44621362-44621384 CTGCTGCCTTTGCCCAGCTCTGG - Intronic
1175022576 20:55865979-55866001 CTGAGCTCCCTGCTCAGCACTGG - Intergenic
1175215556 20:57390256-57390278 CTGCGGCCTCCTCTCAGCACAGG - Intergenic
1175785228 20:61708023-61708045 CTGCCTCCTCTCCTCAGCACTGG - Intronic
1175794829 20:61765125-61765147 GCCCTGTCCCTGCTCAGCACTGG + Intronic
1175898428 20:62350447-62350469 CTCCCGCCTCTGCTCGGCACTGG + Intronic
1176066836 20:63202196-63202218 CTGCCGCATCTGCTCACCACCGG + Intronic
1176104220 20:63378102-63378124 TTGGTGTTGCTGCTCAGCACGGG - Intronic
1176258633 20:64167178-64167200 CTGCTCTCTCTGCACAGTACTGG - Intronic
1177990804 21:28034051-28034073 CTGATGCCTCTATTCAGCACTGG - Intergenic
1178352156 21:31879929-31879951 CTTCTTTCTCTACTCAGCCCTGG + Intronic
1180096579 21:45558117-45558139 CTCCAGTCTCTCGTCAGCACGGG - Intergenic
1180974734 22:19842094-19842116 CTGAGGTCTCTGCTCAGGACAGG - Intronic
1181842787 22:25678892-25678914 ATGTTGTCTCTTGTCAGCACAGG + Exonic
1182012786 22:27014536-27014558 CTGTTGTATCTGCCCAGCTCAGG + Intergenic
1183377860 22:37475547-37475569 TTCCTGTCTCCCCTCAGCACTGG - Intronic
1183539757 22:38423220-38423242 CTGCTGGCTCAGCTCTGCTCGGG - Intergenic
1184226027 22:43129261-43129283 CTGCTGCCGCTGCTCAGCGGGGG + Exonic
1184409397 22:44317919-44317941 CTGCCCTGTCTGCTGAGCACGGG + Intergenic
1185097257 22:48817536-48817558 CTGTTGTGTGTGCTCAGCCCGGG + Intronic
1185415403 22:50706571-50706593 CTGCTGGCTCTGCCAGGCACTGG + Intergenic
950004929 3:9685536-9685558 TTGTTCTCTCTGCTCAGCTCTGG + Intronic
950363108 3:12463755-12463777 CTGCAATCTCAGCTGAGCACTGG + Intergenic
951508895 3:23479967-23479989 CTGCAGACTTTGCTCAGAACTGG + Intronic
953666858 3:44931550-44931572 CTGCCCTCACTGCTCAGCCCTGG - Intronic
954078186 3:48196395-48196417 GTGCTGTCTTTGCTCAGTCCCGG + Intergenic
954374731 3:50188300-50188322 CTGCCGTCTCTGACCAGCATGGG - Exonic
954544188 3:51418800-51418822 CTGCTGTGCATTCTCAGCACGGG - Exonic
954624235 3:52013821-52013843 CTGCATTCTCTGCCCAGCTCTGG + Intergenic
954913229 3:54126537-54126559 CTTCTGTCTTTACTGAGCACAGG + Intronic
960958878 3:123055124-123055146 CTGGTGCCTCAGCTCAGCATCGG - Intergenic
961726811 3:128936157-128936179 CTGCTGTCATTGCCCTGCACTGG + Intronic
963007205 3:140737470-140737492 GGGCTGTCTCTGCTCCCCACTGG - Intergenic
967171153 3:186824712-186824734 CTGCTTTCTCTGCTCTCCCCAGG - Intergenic
967186482 3:186948838-186948860 CTGGTTTCTCTGCACAGCCCTGG + Intronic
967890508 3:194361173-194361195 ATGCTCTCTCTGCTCTGAACAGG + Intronic
968045894 3:195623857-195623879 CAGAGGTCTCTGCTCAGCCCTGG + Intergenic
968308760 3:197666230-197666252 CAGAGGTCTCTGCTCAGCCCTGG - Intergenic
968434138 4:576280-576302 CTGCGGTCTCTGCGCCGCATCGG - Intergenic
968521583 4:1036827-1036849 CAGCTGTCCCCGCTCAGCCCTGG - Intergenic
968713254 4:2136155-2136177 GTGCTCTCTCTGCTCAGCTTAGG - Intronic
971302632 4:25454496-25454518 CTGCTGTCACTGCTCTTCAGAGG - Intergenic
973724723 4:53763913-53763935 CTGCTGTCACTGTGCACCACAGG + Intronic
976331000 4:83830995-83831017 CAGGAGTCTCTGCTCAGCAGAGG - Intergenic
977764048 4:100776830-100776852 CTGAGCTCTCTGCTCAGCCCTGG + Intronic
981499672 4:145436497-145436519 ATGGTATCTCTGCTCAGCCCAGG - Intergenic
981990523 4:150914302-150914324 CTGCTGTTTCTGATGAGCCCAGG + Exonic
985290239 4:188379293-188379315 CTGAAGACTCTGCTGAGCACAGG - Intergenic
985747396 5:1654985-1655007 CAGAGGTCTCTGCTCAGCCCAGG - Intergenic
986751106 5:10788550-10788572 CTGCTGTCCATGCTAAGCACAGG + Intergenic
988646861 5:33104759-33104781 CTGAGCTCCCTGCTCAGCACTGG + Intergenic
992884119 5:81140766-81140788 TTACTGTCTCTTCTCAGCAAAGG + Intronic
993323226 5:86501639-86501661 CTACTCTCTTTGCTCACCACAGG - Intergenic
995249515 5:109975008-109975030 CTGCTCCCTCTGCCCAGCACTGG + Intergenic
995452419 5:112316755-112316777 CAGCTGTCTCTTCTGAGCCCTGG - Intronic
995553112 5:113299934-113299956 CTGCTGCCTCTTCTCATCCCAGG - Intronic
999034852 5:148336124-148336146 CTTCTGTCTCTACTGAGCTCTGG + Intronic
999274395 5:150319327-150319349 GTGTTTTCTCTGCTCAGCAAAGG - Intronic
1000207362 5:159075328-159075350 CTGCTGCTTCTGCAGAGCACAGG - Intronic
1002098290 5:176844869-176844891 CTGCTGTCTGTCATGAGCACTGG - Intronic
1002983218 6:2162785-2162807 CTGCTGTCTCCTCTCAACCCAGG - Intronic
1003523467 6:6878841-6878863 CTGCTGTCTGTGCACAGACCTGG - Intergenic
1003557318 6:7151676-7151698 CTGCAGTGTGTGCTCAGCAGTGG - Intronic
1003578154 6:7315952-7315974 CTGTTGTCGCTGCTAAGCTCAGG - Intronic
1003581111 6:7341762-7341784 CTGCTCTGTCTTCTCTGCACTGG - Intronic
1004128156 6:12893908-12893930 CTGCACTCTCTGCTGAGCAGGGG + Intronic
1005166148 6:22923367-22923389 CTGGTGTCACTGCTCACCATTGG + Intergenic
1007967231 6:46014562-46014584 CGACTGTTTCTGCTCAGCCCTGG + Intronic
1016372192 6:143386698-143386720 CTGCTGTCCCTGCTTGGAACTGG - Intergenic
1017028400 6:150200518-150200540 CTCCAGTCTCTGCTCAGCAGTGG - Intronic
1018534439 6:164805458-164805480 GTGTTGTCCCTGCACAGCACTGG - Intergenic
1018901818 6:168055455-168055477 CTGCTGTGTCTCCCCAACACTGG + Intergenic
1018924246 6:168195333-168195355 CTACAGTCTCTGCTCCACACGGG + Intergenic
1019281077 7:200524-200546 CTGCTGTCTCTGCTCAGCACGGG - Intronic
1019317953 7:399923-399945 CTGCTGTATCTCCTCCACACAGG + Intergenic
1019597348 7:1864289-1864311 GGCCTGTCTCAGCTCAGCACTGG + Intronic
1019758532 7:2791304-2791326 CTGCTGTCTGTGACCAGCAGTGG + Intronic
1020009100 7:4798837-4798859 CTGATCCCGCTGCTCAGCACAGG - Intronic
1022388595 7:29924454-29924476 CTGCTGTCTCGCCCCTGCACAGG + Intronic
1022454831 7:30549278-30549300 CTGCTGGCTCTTCTCACCACCGG + Intronic
1023166100 7:37345245-37345267 CTGCTGTATATCCTCAGCATGGG - Intronic
1023862114 7:44222951-44222973 CTGCTGTCACTGTGCAGCAGGGG - Intronic
1024113381 7:46169820-46169842 CTGCTCTCTCAGCTCAGCTTAGG + Intergenic
1024507907 7:50178526-50178548 CTGCTCTCTCAGCAGAGCACCGG - Intergenic
1025610699 7:63073451-63073473 CTGGAGTCTCTGCTCCACACAGG + Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030862376 7:114650699-114650721 CTGCTCTCTAAGCTCAGCTCAGG - Intronic
1034307165 7:150053472-150053494 CTGTTCTCTCTGCTGACCACTGG + Intergenic
1034386797 7:150747212-150747234 CTGCTGCCTCTGCTCCTCCCCGG + Intronic
1034753191 7:153590276-153590298 CTGCCGTCACTGCTGAGCTCGGG + Intergenic
1034799682 7:154047211-154047233 CTGTTCTCTCTGCTGACCACTGG - Intronic
1035443045 7:158919893-158919915 CTGCTGTCACTGCTCAGTGTCGG - Intronic
1036032954 8:4992680-4992702 CAGCGGCCTCTGGTCAGCACTGG - Intronic
1036220999 8:6921610-6921632 CTGATGTCCATGCTCAGCATCGG - Intergenic
1037748039 8:21662192-21662214 CTGTCATCTCTCCTCAGCACAGG - Intergenic
1038205990 8:25465759-25465781 AAGCTGTTTCTACTCAGCACGGG - Intronic
1039339033 8:36626700-36626722 GTTCTGTCTCGGGTCAGCACTGG - Intergenic
1041257893 8:55995186-55995208 CTGCTGTTTCTGGGCAGCAGAGG + Intronic
1044430654 8:92103059-92103081 CAGCTCTCTCTGCGCAGCGCCGG - Intronic
1045426666 8:102073853-102073875 TTGCTGTCTCTTTTCACCACAGG + Intronic
1047890609 8:129303975-129303997 CTGCTGTCTCTGCACAGGAGAGG + Intergenic
1048904127 8:139070838-139070860 CTGCTATTTCTGGTCATCACTGG - Intergenic
1049559493 8:143301929-143301951 CGGCTCTCTCTGCCCAGCCCTGG - Intergenic
1050847801 9:10245238-10245260 ATGCTGTCTCTGCTTTACACAGG - Intronic
1051591291 9:18778320-18778342 CTGCATTCTCTGCCCAGCCCTGG - Intronic
1053353238 9:37426988-37427010 ACGTTGGCTCTGCTCAGCACTGG + Intronic
1056032569 9:82568167-82568189 CTCATGTGTCAGCTCAGCACAGG + Intergenic
1056467954 9:86877429-86877451 CTGCTGACTCTGCTAAGCTGGGG - Intergenic
1056768416 9:89459619-89459641 CAGCTGTCCCTGCTCAGCCCTGG + Intronic
1057939986 9:99273476-99273498 CTGCTGTCTCTTCTGAGCTCTGG + Intergenic
1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG + Intronic
1059320257 9:113463550-113463572 CTGCCGTCGCTGCTCAGCGCGGG + Intronic
1060228073 9:121808305-121808327 CTGCTGAGTCTGCTGTGCACTGG + Intergenic
1060253067 9:122001634-122001656 CTGCTGTCTCTGCCCACCCTGGG - Intronic
1060975072 9:127760274-127760296 CTACTCTCAGTGCTCAGCACAGG + Intronic
1062013242 9:134278005-134278027 GAGCTGTCACTGCTCAGCAGAGG - Intergenic
1062191816 9:135251742-135251764 CTGCTGTCTTGGCTGAGCACAGG - Intergenic
1062677974 9:137759482-137759504 CTGCTGTCTCTGGTGAGGTCGGG + Intronic
1186433886 X:9527234-9527256 CAGCTGTCTCTACTCACCACGGG + Intronic
1186830480 X:13385032-13385054 CTGCTGTGTGTGCTCAGCTTGGG - Intergenic
1191860215 X:65660078-65660100 CGGCTGCCTCTGCTCTGCTCTGG + Intronic
1193223771 X:78957603-78957625 CTTCTGCCTCTCCTCATCACGGG + Intronic
1195033592 X:100949788-100949810 CATCTGTGTCAGCTCAGCACTGG - Intergenic
1198006670 X:132501749-132501771 TTGCTGTCTCTGCTCAGGGGAGG + Intergenic
1198975810 X:142333913-142333935 CTGAGCTCTCTGCTCAGCCCAGG - Intergenic
1200009103 X:153108138-153108160 CTCTTATCTCTGCTCACCACGGG + Intergenic
1200030497 X:153291784-153291806 CTCTTATCTCTGCTCACCACGGG - Intergenic
1200683925 Y:6244110-6244132 CTCCCGTCTCTGGTCAGCCCAGG - Intergenic
1200831582 Y:7691660-7691682 CTCCTGTCTCTGGTCAGCCCAGG + Intergenic
1200909324 Y:8516498-8516520 GTCCTGTCTCTGTCCAGCACTGG + Intergenic
1200989417 Y:9335343-9335365 CTCCGGTCTCTGGTCAGCCCAGG - Intergenic
1200992091 Y:9355676-9355698 CTCCCGTCTCTGGTCAGCCCAGG - Intergenic
1200994744 Y:9375954-9375976 CTCCCGTCTCTGGTCAGCCCAGG - Intronic
1200997407 Y:9396300-9396322 CTCCCGTCTCTGGTCAGCCCAGG - Intergenic
1200999920 Y:9464836-9464858 CTCCCGTCTCTGGTCAGCCCAGG - Intergenic
1201002580 Y:9485146-9485168 CTCCCGTCTCTGGTCAGCCCAGG - Intronic
1201005236 Y:9505430-9505452 CTCCCGTCTCTGGTCAGCCCAGG - Intergenic
1201007897 Y:9525759-9525781 CTCCCGTCTCTGGTCAGCCCAGG - Intergenic
1201010513 Y:9545950-9545972 CTCCCGTCTCTGGTCAGCCCAGG - Intergenic
1201048710 Y:9910276-9910298 CTCCCGTCTCTGGTCAGCCCAGG + Intergenic
1201143138 Y:11044917-11044939 ATGCTGTGTCTGTGCAGCACGGG + Intergenic