ID: 1019281704

View in Genome Browser
Species Human (GRCh38)
Location 7:203601-203623
Sequence GACCCACTTGGTAGACTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019281702_1019281704 -3 Left 1019281702 7:203581-203603 CCAAATGTCTTTCAGCAGAAGAC 0: 1
1: 0
2: 3
3: 48
4: 524
Right 1019281704 7:203601-203623 GACCCACTTGGTAGACTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019281704 Original CRISPR GACCCACTTGGTAGACTGAG TGG Intronic
No off target data available for this crispr