ID: 1019282558

View in Genome Browser
Species Human (GRCh38)
Location 7:207764-207786
Sequence GGCCTCCAGGTCGCCCGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019282558_1019282567 15 Left 1019282558 7:207764-207786 CCATCTCGGGCGACCTGGAGGCC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1019282567 7:207802-207824 TTAGCTCCCGGGGCTGCCCCAGG No data
1019282558_1019282564 4 Left 1019282558 7:207764-207786 CCATCTCGGGCGACCTGGAGGCC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1019282564 7:207791-207813 CTGTGGCCAGCTTAGCTCCCGGG No data
1019282558_1019282565 5 Left 1019282558 7:207764-207786 CCATCTCGGGCGACCTGGAGGCC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1019282565 7:207792-207814 TGTGGCCAGCTTAGCTCCCGGGG No data
1019282558_1019282569 21 Left 1019282558 7:207764-207786 CCATCTCGGGCGACCTGGAGGCC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1019282569 7:207808-207830 CCCGGGGCTGCCCCAGGCCGAGG No data
1019282558_1019282563 3 Left 1019282558 7:207764-207786 CCATCTCGGGCGACCTGGAGGCC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1019282563 7:207790-207812 GCTGTGGCCAGCTTAGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019282558 Original CRISPR GGCCTCCAGGTCGCCCGAGA TGG (reversed) Intronic
900382492 1:2391797-2391819 CGCCTCCAGGGCCCCCAAGATGG - Intronic
903657694 1:24959225-24959247 GGCCTCCAGCCCGCCAGAGTGGG + Intronic
907091642 1:51730211-51730233 GGCCTCCAGTTCCACCGAGAGGG + Intronic
915091676 1:153430436-153430458 GGCCTCCAGGTCACTCCAGAAGG + Intergenic
1063066621 10:2616411-2616433 GGCCTCCAGGTGGCCCTAGAGGG - Intergenic
1067416376 10:46106314-46106336 GGCCGCCAGGTCGCGCGGGGAGG + Intergenic
1067436511 10:46282792-46282814 GGCCGCCAGGTCGCGCGGGGAGG + Intergenic
1067721060 10:48728097-48728119 GGCCTCCAGAGCTCCCCAGAAGG + Intronic
1069850302 10:71399864-71399886 TGCCTCTAGGACGCCTGAGACGG + Intronic
1073131172 10:101190131-101190153 GACCCCCAGGTGGCCTGAGAAGG + Intergenic
1076793063 10:132786798-132786820 GGCCTCCAGGTCTCCCGCTGGGG + Intergenic
1077174300 11:1181661-1181683 GGCCTCCAAGTCACCCCAGCAGG + Intronic
1079128359 11:17734327-17734349 GGCCTCCAGGTTCCGCGAGAAGG + Intergenic
1083623489 11:64060237-64060259 GGCCTCCTGGGCGCCCGCGTGGG - Intronic
1084313435 11:68330167-68330189 GGCCACCAGGGCTCCCCAGAAGG - Intronic
1084469550 11:69349005-69349027 GGCCTCCAGTTCCACGGAGAAGG - Intronic
1084516116 11:69638879-69638901 GGCCCCCGGGTCCCCCGAGGGGG - Intergenic
1086067099 11:82757119-82757141 GCCCTCCAGGTCCTCTGAGAGGG - Intergenic
1086936147 11:92747459-92747481 GGCCTCCAGGAAGCCTGTGATGG + Intronic
1091197992 11:133747922-133747944 GGCCTCCAGGATGCCACAGATGG + Intergenic
1097058850 12:56267457-56267479 GGACCCCAGGGCGCCCGCGAGGG - Intronic
1101839591 12:108318599-108318621 GGCCTCCTCGTCACCCCAGAGGG + Intronic
1106123702 13:26882865-26882887 GGACTCCAGGCTGACCGAGAAGG - Intergenic
1106224438 13:27774425-27774447 AGCCTCCATGTCGGCAGAGATGG + Intergenic
1122206172 14:100149100-100149122 GGCCACGAAGTGGCCCGAGATGG + Exonic
1122630356 14:103104769-103104791 GGCCTCCAGCTCCGCGGAGATGG - Exonic
1122920154 14:104876648-104876670 GGCCCCCAGGCCTCCCCAGAAGG + Intronic
1123068358 14:105629221-105629243 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123092377 14:105747545-105747567 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123097955 14:105775246-105775268 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1124664642 15:31581746-31581768 GGCCTCCAGGCCTCCTGTGATGG + Intronic
1125387404 15:39152876-39152898 GGCCTCCAGTTGACCCGTGATGG + Intergenic
1129207233 15:74044467-74044489 GGCAGCCAGGAAGCCCGAGATGG - Exonic
1129229530 15:74189088-74189110 GGCCTCCAGGGAGCCCCTGAGGG - Intronic
1129556761 15:76518160-76518182 AGACTCCAGGTGGCCCAAGATGG + Intronic
1131831942 15:96360062-96360084 CGCATCCAGGTCCCCAGAGAGGG - Intergenic
1134683671 16:16144021-16144043 GGCCTCCAGGTCCCCACAGTGGG + Intergenic
1135415727 16:22266788-22266810 GGCCTCCAGCTCGCCCAGGTTGG - Exonic
1137063369 16:35811922-35811944 GGCCTGCAGGTCACTCAAGAGGG - Intergenic
1142619380 17:1154999-1155021 GGCCCCCAGGGCGCCCGGGAAGG - Intronic
1144244823 17:13352539-13352561 GGCCTCAAGGTGGCCCAAGGAGG - Intergenic
1147110307 17:38256907-38256929 GGCCTCCAGCTTGCCCTCGAAGG + Intergenic
1148090515 17:45020216-45020238 GGCATCCAGGTCGGCATAGAAGG + Intergenic
1148419203 17:47531524-47531546 GGCCTCCAGCTTGCCCTCGAAGG - Exonic
1157472704 18:48002367-48002389 GGCCTCCAGCACTTCCGAGATGG + Intergenic
1158367326 18:56752376-56752398 GGTTTCCCGGTCACCCGAGATGG + Intronic
1161302270 19:3548401-3548423 GGCCTCCAGGAAGCCCGTGCTGG + Intronic
1163399903 19:17085930-17085952 AGCCCACAGGTCACCCGAGAAGG + Intronic
1163831034 19:19547280-19547302 GGCCTCCAGGGCACCTGGGATGG + Intergenic
1165175602 19:33927472-33927494 GGCCACCAGGTTGCCTAAGAAGG - Intergenic
1166930645 19:46299211-46299233 TGCCTCCAGATCGCCCCAGCTGG - Intronic
925625967 2:5842321-5842343 GGACTCCAGGTCACCGGCGATGG + Intergenic
932137301 2:69242543-69242565 GGCCACCAGGCTGGCCGAGAGGG - Intronic
937300000 2:120833206-120833228 GGCCTCCAGGGCCTACGAGATGG + Intronic
944573721 2:201071370-201071392 GGCCCCCACGTCGCCCCACAAGG + Intronic
944768019 2:202884500-202884522 TGCCTCCATGTGGCCAGAGAGGG + Exonic
948541748 2:238696216-238696238 TGCCTCCAGGCCCCCCGAGCAGG - Intergenic
948687546 2:239678318-239678340 GGCCTCCAGGGCCCTCCAGATGG + Intergenic
1172882910 20:38213300-38213322 GGCCTCCTGGGCCCCCCAGAGGG - Exonic
1178922477 21:36747769-36747791 GCCCGCCAGGCCGCCCGGGACGG + Exonic
1180228333 21:46411730-46411752 GGCCTCCAGCTCGGCAGAGTGGG - Exonic
1180830593 22:18904018-18904040 GGCCTCCAGGTCCCTCGGAATGG - Intergenic
1180901748 22:19378012-19378034 GCCCGCCAGGGAGCCCGAGAGGG + Exonic
1181808133 22:25387360-25387382 GGCCACCAGGGCTCCCCAGAAGG + Intronic
1182154468 22:28056281-28056303 GGCCACCAGGTTGCCTGAGGAGG - Intronic
1185216556 22:49603178-49603200 GTCCTTCAGGTCGCCCAGGAAGG - Intronic
1203280683 22_KI270734v1_random:129289-129311 GGCCTCCAGGTCCCTCGGAATGG - Intergenic
950345373 3:12287975-12287997 GGCCTCGAGGACACCGGAGAGGG + Intronic
951013772 3:17706088-17706110 GGCCTCCAGCTTGCCCTCGAAGG + Intronic
968965695 4:3768095-3768117 GGCCTCCAGGGCGCAGGGGAGGG + Exonic
973079844 4:45977228-45977250 GCCCTCCAGTTCACCTGAGAGGG - Intergenic
978618706 4:110619527-110619549 GGCCTCCCTGTCGCCCCAGACGG + Intronic
985895990 5:2750502-2750524 CGCCCCCAGGTCGCCGGAGCAGG + Intronic
991544385 5:67765294-67765316 GGCCTCCAGTGAGCCCCAGATGG - Intergenic
992561622 5:77958098-77958120 GCCCTCCCGGCCGCCCGAGGTGG - Intergenic
1006429176 6:33984622-33984644 GTCCTCCTGGTTGCCCGAGTTGG - Intergenic
1007088370 6:39166633-39166655 GGACTCGAGGTCTCCAGAGACGG + Intergenic
1013836719 6:114342882-114342904 GGCCCCCAGAGCGCCCGAGCCGG + Exonic
1015745700 6:136507290-136507312 GGCCTCCAGGAGTCCAGAGAGGG - Intronic
1017530856 6:155290950-155290972 GGCCTCTAGGTAGCTCAAGATGG + Intronic
1018812049 6:167305428-167305450 GCCCTTGAGGTCGCCCGTGATGG + Intronic
1019282558 7:207764-207786 GGCCTCCAGGTCGCCCGAGATGG - Intronic
1022511159 7:30935622-30935644 GCCCTCCAGGTCCTCCCAGAGGG + Intergenic
1023221132 7:37920965-37920987 GGCACCCAGGGCGCCCGGGACGG - Exonic
1023792998 7:43768777-43768799 GGCCTCCAGGTAGCCAGGGGAGG + Intronic
1023842826 7:44106628-44106650 GTCCCCCAGGCCGCCCAAGAAGG + Exonic
1026800255 7:73395912-73395934 GGACTCCAGGACTCCAGAGAGGG + Intergenic
1029204822 7:98863321-98863343 GGCCACCAGGCTGGCCGAGATGG + Exonic
1029346252 7:99980827-99980849 GTCCTCCAGGAGACCCGAGATGG + Intergenic
1033599386 7:142877718-142877740 GGCCTCCAGGTTGTCATAGAGGG + Exonic
1034919910 7:155071147-155071169 GGCCACCAGGACATCCGAGACGG - Exonic
1035207634 7:157304492-157304514 GGCCACCAGGTTGCCCAAGGTGG - Intergenic
1036487193 8:9189861-9189883 GGCCTTCAGCTCCCCAGAGAGGG - Intergenic
1045657697 8:104403917-104403939 GGCCTCCAGCTTTCCTGAGAAGG + Intronic
1046096392 8:109567239-109567261 GCCCTCCAGTTCACCTGAGAGGG - Intergenic
1046135340 8:110018668-110018690 GGCCTCCAGGTGGCACATGAAGG + Intergenic
1049347872 8:142148341-142148363 GGGCTTCAGGGTGCCCGAGAGGG - Intergenic
1049463169 8:142739399-142739421 GTCCTCCAGGCCGGCCGAGAGGG + Intergenic
1049796151 8:144498148-144498170 TGCCTCCAGGCCTCCCGGGAGGG - Intronic
1057063425 9:92026275-92026297 GGCCTCCAGGAGCCCTGAGAGGG + Intergenic
1057914860 9:99047824-99047846 TACCTACAGGTCGCCCGGGAAGG - Exonic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic