ID: 1019283478

View in Genome Browser
Species Human (GRCh38)
Location 7:211825-211847
Sequence CCACGTGCCCTGTGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 195}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019283478_1019283489 10 Left 1019283478 7:211825-211847 CCGTCTTCCCACAGGGCACGTGG 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1019283489 7:211858-211880 CAGGGACCCCACACCTCAGGCGG 0: 1
1: 0
2: 2
3: 18
4: 224
1019283478_1019283488 7 Left 1019283478 7:211825-211847 CCGTCTTCCCACAGGGCACGTGG 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1019283488 7:211855-211877 AGGCAGGGACCCCACACCTCAGG 0: 1
1: 0
2: 3
3: 20
4: 306
1019283478_1019283491 14 Left 1019283478 7:211825-211847 CCGTCTTCCCACAGGGCACGTGG 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1019283491 7:211862-211884 GACCCCACACCTCAGGCGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 138
1019283478_1019283486 -9 Left 1019283478 7:211825-211847 CCGTCTTCCCACAGGGCACGTGG 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1019283486 7:211839-211861 GGCACGTGGCGGGCGGAGGCAGG 0: 1
1: 0
2: 10
3: 150
4: 1718
1019283478_1019283490 11 Left 1019283478 7:211825-211847 CCGTCTTCCCACAGGGCACGTGG 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1019283490 7:211859-211881 AGGGACCCCACACCTCAGGCGGG 0: 1
1: 0
2: 3
3: 18
4: 204
1019283478_1019283487 -8 Left 1019283478 7:211825-211847 CCGTCTTCCCACAGGGCACGTGG 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1019283487 7:211840-211862 GCACGTGGCGGGCGGAGGCAGGG No data
1019283478_1019283492 15 Left 1019283478 7:211825-211847 CCGTCTTCCCACAGGGCACGTGG 0: 1
1: 0
2: 1
3: 19
4: 195
Right 1019283492 7:211863-211885 ACCCCACACCTCAGGCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019283478 Original CRISPR CCACGTGCCCTGTGGGAAGA CGG (reversed) Intronic
900365460 1:2310349-2310371 CCACGTGCCCTCGGGGTCGACGG - Intergenic
902929888 1:19723549-19723571 TCAGGGACCCTGTGGGAAGAAGG + Intronic
903127322 1:21256860-21256882 CCACAGGCCCTGTGGGACGAAGG + Intronic
905286854 1:36886273-36886295 CCTCGGGCCCTGTGGGGGGAGGG - Intronic
905825064 1:41020908-41020930 ACACAGGGCCTGTGGGAAGACGG + Exonic
905874917 1:41426551-41426573 CCAGGTGCACTGGGGGAAGTAGG - Intergenic
906216169 1:44042044-44042066 CCAGGGGCCGTGTGGGCAGAAGG - Intergenic
906607762 1:47183488-47183510 CCAGCTGCCCTGTGGGCACAGGG + Intergenic
907779300 1:57551179-57551201 CCACGGGCACTGTGGAATGAAGG + Intronic
908317062 1:62942977-62942999 GCTGGGGCCCTGTGGGAAGAAGG + Intergenic
908328743 1:63049593-63049615 TGAAGTGTCCTGTGGGAAGAGGG + Intergenic
915614014 1:157021112-157021134 CCAGTTGCTCTGTAGGAAGATGG + Intronic
917581662 1:176384645-176384667 CCATGTTCCCTGTGGGACTATGG + Intergenic
917617963 1:176765672-176765694 CCATCGGCCCTGTGGGAAGCAGG + Exonic
918253427 1:182725181-182725203 CCACATGCCATGTAGCAAGAGGG + Intergenic
918424385 1:184393299-184393321 ACAGGGGCCCTGAGGGAAGAAGG - Intronic
920005756 1:202832660-202832682 ACAGGTGCCCTGGGGGAAGGTGG + Intergenic
921064569 1:211613552-211613574 CCACTTCCCCTGTGGGGAGCTGG - Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
1067088170 10:43253666-43253688 CCCCGTCCCCTGTGGGATGTTGG - Intronic
1067775820 10:49164212-49164234 GCAGGTGCCCTTTGGGAAGTTGG - Intronic
1069853377 10:71424909-71424931 CCGCATGCCCAGTGGGAGGAAGG + Intronic
1070803658 10:79257724-79257746 CCAGGTGTCCAGTGGAAAGACGG + Intronic
1071269310 10:83992149-83992171 CCACTTCCCCTGTGGGAAGCAGG + Intergenic
1075775146 10:124978551-124978573 CCACCTGCCCCGTGGGAAATTGG - Intronic
1076404890 10:130205123-130205145 CCACAGGCCCTGGTGGAAGAAGG - Intergenic
1078068458 11:8093279-8093301 GCAAGGGCCCTGTGGCAAGAGGG + Intronic
1080775465 11:35382147-35382169 CCACGGGCCTTGTAGGAACATGG - Intronic
1081563027 11:44236494-44236516 CCATGTGCACTGTGGGAATTGGG + Intronic
1081611431 11:44565531-44565553 CCCCGAGCCCTTTGGGAAGGCGG - Intronic
1083207376 11:61160971-61160993 CCGCGTGCCCTCTGGCAAGTCGG + Intronic
1084965386 11:72741771-72741793 CCACGTGCCCTGGGGGCCGAGGG + Intronic
1085016775 11:73178959-73178981 GCTCCTGCCCTGGGGGAAGAGGG - Intergenic
1085197576 11:74681805-74681827 CCCCGTCCCCTGGGGGAAGAGGG + Intergenic
1091225273 11:133953357-133953379 GCCTGTGCCCTGTGGGAAGCTGG - Intronic
1092126034 12:6075543-6075565 CCACAGGCCCTGCAGGAAGAGGG + Exonic
1095976509 12:47943870-47943892 CCCCATGCCCTCTGGGAAGCAGG + Intergenic
1098793809 12:74863339-74863361 CAACTTTCCCTGTGGGTAGATGG - Intergenic
1100032412 12:90209289-90209311 CCTAGTGAGCTGTGGGAAGAGGG + Intergenic
1101966715 12:109287137-109287159 CCACGTGGCCTTGGGGAAGTGGG - Intronic
1102302575 12:111781388-111781410 CCAGCTGCCATGTGGGAAGTCGG + Intronic
1102467992 12:113141700-113141722 CCACAGGCCATGTGGCAAGAGGG + Intergenic
1102494784 12:113312044-113312066 GCAAGGGCTCTGTGGGAAGAGGG + Intronic
1102571765 12:113831067-113831089 CCTGGTGCCCTGTGGGAATGTGG + Intronic
1103200039 12:119080593-119080615 CCACGTGCAACATGGGAAGAAGG - Intronic
1107708154 13:43127299-43127321 CCAGTTGCCCTGTGGGCAGAGGG - Intergenic
1108005506 13:45942063-45942085 CCACTTGCCTTGTGGAAAGATGG - Intergenic
1111770218 13:92586754-92586776 CCAAGTGCCCTGGGAGCAGAGGG + Intronic
1119259309 14:73228162-73228184 CCAAGTTCCCAGTGGGAAGATGG - Intergenic
1122294821 14:100699455-100699477 CCTGGTGGCCAGTGGGAAGAGGG + Intergenic
1122784067 14:104155845-104155867 GCTCGGGCCCTGTGGGAAGAGGG + Intronic
1123024787 14:105419616-105419638 CCTGGTGCCCTGGGGGTAGAGGG - Intronic
1123708019 15:22964614-22964636 CCATGTTCCCTCTGGGAAAAAGG + Intronic
1124434226 15:29634251-29634273 CCACTTGCCCTGTGGGGTAAGGG + Intergenic
1124709275 15:31992131-31992153 ACACATTCCCTGTGGGAAGCAGG + Intergenic
1126688094 15:51265784-51265806 GCCCCTGCCCTGTGGAAAGAGGG - Intronic
1128727988 15:70001843-70001865 CCACCTGGCTTGGGGGAAGAGGG + Intergenic
1128768818 15:70266889-70266911 CCACGTGCGATGGGGGAGGAAGG - Intergenic
1128888164 15:71307303-71307325 CCAAGTTACATGTGGGAAGACGG - Intronic
1131336454 15:91553750-91553772 GCAGGTGCCCTGTGGGGACAGGG + Intergenic
1131372981 15:91898989-91899011 CCAAGTGCCATATGGGAAGGAGG + Intronic
1131501081 15:92967016-92967038 GCACATGCCCTCTGGTAAGATGG - Intronic
1138389601 16:56660711-56660733 GCAGGTGCCCTTTGTGAAGAGGG + Intronic
1139198198 16:64945883-64945905 GCACGTGCCCTGTGTGTAGGGGG + Exonic
1142896044 17:2979813-2979835 ACACTTGCCTTGTGGGAAAACGG - Intronic
1143412900 17:6722751-6722773 CCAAGTGCTTTGGGGGAAGACGG - Intergenic
1143575481 17:7790156-7790178 TCACGTGCCCTCTGGGCAGGGGG + Intronic
1145206584 17:20987685-20987707 CCCAGTGCCCTCTGGGAAGGGGG - Intergenic
1145789058 17:27613538-27613560 CCACATGCACTGGGGGAATAGGG - Intronic
1147309712 17:39588020-39588042 CCACCTTCCCTGGGGGCAGAAGG + Intergenic
1148675612 17:49443010-49443032 CCACTAGCCCTGTTGGGAGAAGG + Intronic
1150191307 17:63242982-63243004 ACAGGTGCCCTGTGGGAATTAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150505686 17:65696374-65696396 CCACATGTCCTTTGGGAAGTGGG + Intronic
1152120178 17:78413679-78413701 CTGGGTGCCCTGTGGGAGGAAGG + Intronic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1152729613 17:81962998-81963020 CAACCTGCCCTGTGGGGAGAGGG - Intergenic
1159086944 18:63803769-63803791 CCACGTGGCCTGAGGCAAGGAGG - Intronic
1159887630 18:73924199-73924221 CCTCATGGCCTGGGGGAAGAGGG - Intergenic
1160613674 18:80108463-80108485 CCACGTGCTCTGGGGCACGAGGG + Intergenic
1160833672 19:1114597-1114619 CCCCGTGCCCTGTGGCCAGGAGG + Intronic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1162128277 19:8511016-8511038 CCGCGTGCCCTGCGGGCAGGCGG + Exonic
1163181551 19:15607862-15607884 CCACGAGCCCACTGGGAGGAAGG - Intergenic
1163410457 19:17150662-17150684 CCAGGGCCCCTGTGGGAAGAGGG - Intronic
1164781611 19:30897457-30897479 CCATGTGCCCTGTTGCAAGCTGG + Intergenic
1164822800 19:31263536-31263558 AGACGTGCCCTGTGGCAAGTGGG + Intergenic
1164895801 19:31876676-31876698 CAACATGCCCTGTGGACAGATGG + Intergenic
1165158794 19:33803896-33803918 CCACCTGCCCTGTGTGCACAAGG - Intronic
1168498025 19:56870247-56870269 CCACGTGCCCTCTGAGGAGCTGG + Intergenic
925973078 2:9121301-9121323 TCACCTGACCTGTGGGCAGAAGG - Intergenic
926323586 2:11765685-11765707 CCACGTCCGCTTTGGGAAGATGG + Exonic
927091160 2:19713741-19713763 CCACGTGCCCTCTGAGAAGAGGG + Intergenic
927464065 2:23324003-23324025 CCCAGTGCCCTGTGGGGAGCAGG - Intergenic
929233858 2:39586303-39586325 CCACGAGCCCACTGGGAGGAAGG + Intergenic
935962976 2:108445435-108445457 CCACATGCACTGGGGGAATAGGG + Intergenic
937218562 2:120328103-120328125 CTCCATGCTCTGTGGGAAGAGGG + Intergenic
938478332 2:131635849-131635871 CCACGTGGGCTGTGGGAACCTGG - Intergenic
938801470 2:134767126-134767148 CCACGTGTGCTTGGGGAAGAAGG + Intergenic
944684600 2:202106872-202106894 GCACGTGCCCTTTGGAAAGGAGG - Intronic
946472987 2:219980280-219980302 CCCCTTGCTCTGTGGGGAGAAGG + Intergenic
948927509 2:241108749-241108771 ACACATGCCCTTTAGGAAGATGG + Intronic
1172444304 20:34985052-34985074 GAACTTGCCCTGTGGGCAGAGGG - Exonic
1173847138 20:46195384-46195406 ACACGTGCTCTGTGGCATGAAGG + Intronic
1174277659 20:49415505-49415527 CCATCTGCCCTGTGGCAGGAGGG - Intronic
1174487241 20:50869244-50869266 CCCAGTGCCCTGGGGGATGAAGG + Intronic
1175757973 20:61541884-61541906 CCAGGTGCCCTGAGGGAGGGAGG - Intronic
1176061327 20:63174177-63174199 CCCCGTGCCTGGTGGGGAGAGGG - Intergenic
1179976564 21:44871684-44871706 GCAAGTACTCTGTGGGAAGAGGG + Intronic
1181832412 22:25571652-25571674 CCATGTGCTCTGAGGGAGGAGGG + Intronic
1182062935 22:27410776-27410798 CCACGTGCATTGTGGGAACAGGG + Intergenic
1183028927 22:35087504-35087526 CAAAGACCCCTGTGGGAAGAAGG - Intergenic
1183114689 22:35681828-35681850 CCACATGCCCTGGGGGAATGGGG - Intergenic
1183744592 22:39685447-39685469 CCACGTGCCCTGGGGGAGGGCGG + Intronic
1184257501 22:43295536-43295558 CCTCGTGCCCAGTGGGAATAAGG - Intronic
1184855014 22:47142111-47142133 CCAGGTTCCCAGTAGGAAGATGG + Intronic
1184865287 22:47198837-47198859 CCACGGCCCCTGTGGAAGGAGGG + Intergenic
950546131 3:13639114-13639136 GCACATGCCCTGTGTGAAGGGGG + Intergenic
952625005 3:35393016-35393038 CCACATGCACTGTGGGAATGGGG + Intergenic
955343864 3:58146679-58146701 CCACGTGAGCTGTGGGCAAAGGG - Intronic
955353216 3:58209393-58209415 CCACGGGCCATGTGTGAAGTGGG + Intronic
955719407 3:61865629-61865651 CCACCTGCCCTGTCGGCAGGTGG - Intronic
955870443 3:63432884-63432906 TCAAGTTCCCTGTGGGAAAAGGG + Intronic
956195501 3:66650075-66650097 CAATGTCCCCTGTGGGAAGCTGG - Intergenic
957512375 3:81205831-81205853 ACTGCTGCCCTGTGGGAAGATGG - Intergenic
958256592 3:91332285-91332307 CTACTGGACCTGTGGGAAGAGGG + Intergenic
959996758 3:112688846-112688868 GCAAGAGCCCAGTGGGAAGACGG + Intergenic
961556044 3:127697214-127697236 CCAGGAGCCCTGAGGGAAGGAGG + Intronic
961671168 3:128532558-128532580 CCCCCTGTCCTGTGGGATGAAGG - Intergenic
962837151 3:139199545-139199567 CCAAGTCCCCTGGGGGAGGAGGG - Intronic
963346474 3:144100920-144100942 CCATGTGCCCTGTGCTAGGAAGG + Intergenic
964088988 3:152850884-152850906 CCACTTGACCTCTGGGAACATGG - Intergenic
966247362 3:177824277-177824299 TCACATGCGCTGTGGGAGGAGGG + Intergenic
966631767 3:182084127-182084149 CCGCATGCTCTGAGGGAAGAGGG - Intergenic
968548922 4:1212661-1212683 GCACGGGGCCTGTGGGAGGAGGG - Intronic
969300175 4:6292893-6292915 TCACGGGCCCAGTGGGAAGGTGG - Intronic
975098911 4:70490033-70490055 GCAAGTTTCCTGTGGGAAGAAGG - Intergenic
975292384 4:72692610-72692632 CCACGTGCCATTTGGAAAGTTGG - Intergenic
977417247 4:96749177-96749199 CCTAGTGGCCTGTGAGAAGAGGG - Intergenic
981157420 4:141455891-141455913 CCAGCTGCCCTGAGGGAAGAGGG + Intergenic
990370570 5:55114310-55114332 CCCTGTGGCCTGGGGGAAGAAGG + Exonic
991944786 5:71889570-71889592 CCACTTTCACTCTGGGAAGATGG + Intergenic
996460484 5:123734922-123734944 GCCAGTGCCCTGTGGTAAGAAGG + Intergenic
998266785 5:140672898-140672920 CCACCCAGCCTGTGGGAAGAGGG + Exonic
998367246 5:141639503-141639525 CCAGGTGCACTGTGTGATGATGG - Exonic
999582497 5:153054964-153054986 GCAAATGCCCTGTGGTAAGAGGG - Intergenic
1002551436 5:179995702-179995724 ACACTTCCCCAGTGGGAAGATGG + Intronic
1003860464 6:10318016-10318038 CCATGTGCCCTGTGAGAGGAGGG + Intergenic
1005916468 6:30356454-30356476 CCACATGTCCTGAGGGAAGGGGG - Intergenic
1005959119 6:30683877-30683899 CCAACTGCCCCGTGGGAAGGAGG - Intronic
1007712720 6:43834907-43834929 CCCCGTGCCCTGTGGAGGGAGGG - Intergenic
1007726092 6:43916464-43916486 CCACCACCGCTGTGGGAAGAGGG + Intergenic
1015330189 6:131968836-131968858 CCATGTGCTCTGGAGGAAGAAGG + Intergenic
1016241603 6:141938032-141938054 CCACGTGCCAAATGGGGAGAGGG + Intergenic
1016989609 6:149920156-149920178 CCACGTGGACTGTGGGAGGTGGG + Intronic
1017628005 6:156367965-156367987 CCACCTGCCCTGTGGAGAAAGGG + Intergenic
1018169933 6:161136686-161136708 TCACTTGCTCTGTGGGAAAACGG - Intronic
1019283478 7:211825-211847 CCACGTGCCCTGTGGGAAGACGG - Intronic
1019306909 7:339936-339958 CCGAGGCCCCTGTGGGAAGATGG - Intergenic
1019525092 7:1477227-1477249 CCCCATTCCCTTTGGGAAGATGG + Intronic
1020087031 7:5316064-5316086 CCAGTAACCCTGTGGGAAGAGGG + Exonic
1021146680 7:17097813-17097835 CCAAAAGCCCTGTGGGAATAAGG + Intergenic
1023766200 7:43513342-43513364 CCACGTGCAGTGTGAGAAGAAGG - Intronic
1032407244 7:131665564-131665586 CCATGTGGCCGGTGGGATGAAGG + Intergenic
1035355328 7:158273181-158273203 CCACGTGCCCTGTCCTAGGAGGG - Intronic
1035640480 8:1181415-1181437 TCACGTGCCCTGCAGGAACATGG - Intergenic
1036263223 8:7256619-7256641 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036264526 8:7264241-7264263 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036265825 8:7271863-7271885 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036267127 8:7279485-7279507 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036268430 8:7287107-7287129 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036269734 8:7294729-7294751 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036298156 8:7552325-7552347 CCACGGGCCCTGTGGCAGGTGGG - Intergenic
1036299461 8:7559975-7559997 CCACGGGCCCTGTGGCAGGTGGG - Intergenic
1036300766 8:7567623-7567645 CCACGGGCCCTGTGGCAGGTGGG - Intergenic
1036302073 8:7575269-7575291 CCACGGGCCCTGTGGCAGGTGGG - Intergenic
1036303368 8:7582916-7582938 CCACGGGCCCTGTGGCAGGTGGG - Intergenic
1036315268 8:7715158-7715180 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036316570 8:7722806-7722828 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036317877 8:7730454-7730476 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036319186 8:7738102-7738124 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036320493 8:7745749-7745771 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036321803 8:7753397-7753419 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036323112 8:7761045-7761067 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036324414 8:7768692-7768714 CCACGGGCCCTGTGGCAGGTGGG + Intergenic
1036351620 8:8015615-8015637 CCACGGGCCCTGTGGCAGGTGGG - Intergenic
1036352929 8:8023261-8023283 CCACGGGCCCTGTGGCAGGTGGG - Intergenic
1036354219 8:8030908-8030930 CCACGGGCCCTGTGGCAGGTGGG - Intergenic
1038537015 8:28360745-28360767 CCAGGTGCCCTGTGGCTGGAGGG + Intronic
1038613094 8:29071648-29071670 CCACGTGCCCTCTTGGAAGTCGG + Exonic
1039895588 8:41714418-41714440 CCCAGAGCCCTGTGGGAACAGGG + Intronic
1047407374 8:124596844-124596866 ACACGTGTCTTATGGGAAGATGG - Intronic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1048609056 8:136002012-136002034 CCACCTCTCCTGTAGGAAGATGG - Intergenic
1048901735 8:139044462-139044484 CCAGGTACCCTGTGGAAAAATGG + Intergenic
1049261108 8:141639689-141639711 GCAAGCGCCCTGTGGGAGGAGGG + Intergenic
1049975550 9:858199-858221 TCATGTGGCCAGTGGGAAGAGGG + Intronic
1050821758 9:9888152-9888174 CCATTTGCTATGTGGGAAGATGG - Intronic
1052995980 9:34551858-34551880 CCACCTCCCCTGAGGGAGGAAGG + Exonic
1053055535 9:34991286-34991308 ACACGTGGCCTGTGGGTAGGGGG + Intronic
1054709903 9:68500813-68500835 CCACTTGCCCTGTGCAAATAGGG - Intronic
1054810384 9:69429475-69429497 CCAGGTGCCCTGGGGGGAAAGGG - Exonic
1057228734 9:93306045-93306067 CCAGGTGCCCTCTGGGTAGTTGG + Intronic
1057943026 9:99301458-99301480 GCACATGCCCTTAGGGAAGAAGG + Intergenic
1061544833 9:131298621-131298643 CTATGTGCACTGCGGGAAGAGGG - Intronic
1061661079 9:132130739-132130761 CCAGGTACCCTCTGGGAAGAGGG - Intergenic
1061927487 9:133813099-133813121 CAACGGGGCCTGTGGGAACAGGG - Intronic
1062145924 9:134989623-134989645 CCACGTGCCCCGTGGTGAGCTGG - Intergenic
1062524338 9:136972211-136972233 GCAGGGGCCCCGTGGGAAGAGGG + Intergenic
1185519510 X:728348-728370 CCACGTTCCCTGTGTGTTGAAGG - Intergenic
1186963458 X:14762104-14762126 CAAGGTGCCCTCTTGGAAGAAGG - Intergenic
1189369445 X:40416108-40416130 CCCCGGGCCATGTGGGAGGAGGG + Intergenic
1198533663 X:137567207-137567229 CCACGTGCCCTGTGGGCGACGGG - Exonic
1199981372 X:152922369-152922391 CCATGTGCCCAGTGACAAGACGG + Intronic
1202305505 Y:23465857-23465879 CCACGTACCCTGTGGAAGTACGG - Intergenic
1202565304 Y:26204732-26204754 CCACGTACCCTGTGGAAGTACGG + Intergenic