ID: 1019285035

View in Genome Browser
Species Human (GRCh38)
Location 7:219145-219167
Sequence GGCTTCCTGCATCACGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 124}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019285035_1019285041 -3 Left 1019285035 7:219145-219167 CCTTCTCCGTGATGCAGGAAGCC 0: 1
1: 0
2: 2
3: 14
4: 124
Right 1019285041 7:219165-219187 GCCAGGCTCCACCTGGGGCGAGG No data
1019285035_1019285048 29 Left 1019285035 7:219145-219167 CCTTCTCCGTGATGCAGGAAGCC 0: 1
1: 0
2: 2
3: 14
4: 124
Right 1019285048 7:219197-219219 AGCATGTGACTTTGTTGTCCAGG 0: 1
1: 0
2: 2
3: 87
4: 1375
1019285035_1019285038 -10 Left 1019285035 7:219145-219167 CCTTCTCCGTGATGCAGGAAGCC 0: 1
1: 0
2: 2
3: 14
4: 124
Right 1019285038 7:219158-219180 GCAGGAAGCCAGGCTCCACCTGG No data
1019285035_1019285049 30 Left 1019285035 7:219145-219167 CCTTCTCCGTGATGCAGGAAGCC 0: 1
1: 0
2: 2
3: 14
4: 124
Right 1019285049 7:219198-219220 GCATGTGACTTTGTTGTCCAGGG No data
1019285035_1019285046 6 Left 1019285035 7:219145-219167 CCTTCTCCGTGATGCAGGAAGCC 0: 1
1: 0
2: 2
3: 14
4: 124
Right 1019285046 7:219174-219196 CACCTGGGGCGAGGTTTGAGGGG No data
1019285035_1019285040 -8 Left 1019285035 7:219145-219167 CCTTCTCCGTGATGCAGGAAGCC 0: 1
1: 0
2: 2
3: 14
4: 124
Right 1019285040 7:219160-219182 AGGAAGCCAGGCTCCACCTGGGG No data
1019285035_1019285045 5 Left 1019285035 7:219145-219167 CCTTCTCCGTGATGCAGGAAGCC 0: 1
1: 0
2: 2
3: 14
4: 124
Right 1019285045 7:219173-219195 CCACCTGGGGCGAGGTTTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 131
1019285035_1019285039 -9 Left 1019285035 7:219145-219167 CCTTCTCCGTGATGCAGGAAGCC 0: 1
1: 0
2: 2
3: 14
4: 124
Right 1019285039 7:219159-219181 CAGGAAGCCAGGCTCCACCTGGG No data
1019285035_1019285043 4 Left 1019285035 7:219145-219167 CCTTCTCCGTGATGCAGGAAGCC 0: 1
1: 0
2: 2
3: 14
4: 124
Right 1019285043 7:219172-219194 TCCACCTGGGGCGAGGTTTGAGG 0: 1
1: 0
2: 0
3: 16
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019285035 Original CRISPR GGCTTCCTGCATCACGGAGA AGG (reversed) Intronic
900570849 1:3357531-3357553 CGCTTCCTGGATCAAGGGGAAGG - Intronic
900581217 1:3410607-3410629 TGCTGCCTGCACCCCGGAGAAGG - Intronic
900819700 1:4877131-4877153 CACTACCTGCAGCACGGAGAAGG - Intergenic
900886746 1:5420751-5420773 GGCTTCCTGCAGCAGGGAAGTGG + Intergenic
902145499 1:14395481-14395503 GGCTCCTGGAATCACGGAGAGGG + Intergenic
902744684 1:18465772-18465794 GGCCTCCAGCACCACAGAGAAGG + Intergenic
904365817 1:30010381-30010403 GGCCTCCTGCTCCACGGAGCAGG - Intergenic
905199255 1:36305579-36305601 GGCTTCCTTCATCATGGTGGTGG + Intergenic
905291909 1:36927711-36927733 AGCTTTCTGCAGCGCGGAGATGG - Intronic
907649978 1:56285831-56285853 GGCTTCCTGCAGCACAGATCTGG - Intergenic
909540655 1:76787810-76787832 GGCTTCCTGCATGAGGAAGAGGG + Intergenic
910168310 1:84351563-84351585 GGATTCCTGGATCAAGCAGAAGG + Intronic
912271316 1:108212104-108212126 TGCTGCTAGCATCACGGAGAAGG + Intergenic
912308619 1:108596518-108596540 GGCGTCCTGGACCACAGAGAAGG + Intronic
916089375 1:161295395-161295417 GCCTTCCTCCATCATGGAGGGGG + Intergenic
916534421 1:165690014-165690036 GGCTTTTTGGATCACAGAGAAGG - Intronic
917536158 1:175876166-175876188 TGCTTCCTGAATAACGGACACGG + Intergenic
917797892 1:178544910-178544932 GGCATCCGGCATCTCAGAGATGG - Intronic
919083332 1:192891807-192891829 GGCTTCCTGCTCCAGGGAGCAGG - Intergenic
1063091913 10:2872928-2872950 GCCTTCCTGCCTCACTCAGAGGG - Intergenic
1066259234 10:33712940-33712962 GGCTTCCCGCAGCATGGAGCTGG - Intergenic
1066439149 10:35421295-35421317 AACTTCCTGCAGCACAGAGACGG - Intronic
1070805993 10:79271027-79271049 TGCTTCCTGCATCTCAGAGCAGG + Intronic
1072680510 10:97502755-97502777 GGATTCTTGCATTAGGGAGAAGG + Intronic
1073911928 10:108356010-108356032 GGATTCATGCAGCAAGGAGAAGG - Intergenic
1076625931 10:131822098-131822120 GGCTTCCTGGATGCTGGAGATGG - Intergenic
1077992856 11:7427434-7427456 GGCTGCCTACATCAAGTAGAGGG - Intronic
1078933865 11:15935534-15935556 TGCTTCCTGGAACACGGAGGTGG - Intergenic
1081044197 11:38251060-38251082 GGCTTCCTGGGCCACTGAGAAGG - Intergenic
1083251230 11:61468649-61468671 TGCTTCTTGAATCAGGGAGAAGG + Exonic
1083258526 11:61510664-61510686 GGCCTCCTGCACCGCAGAGAGGG + Exonic
1083799393 11:65037817-65037839 GGCCTCCTGCAGGAGGGAGAAGG - Intronic
1084398697 11:68931379-68931401 GGCTTCCTGCTCCACGAAGCAGG - Intronic
1087588136 11:100148634-100148656 GGCTTCATGCATCTCACAGAAGG - Intronic
1088265571 11:107984627-107984649 GACCTCTTGCATCACGGAAAGGG + Intergenic
1090178833 11:124675492-124675514 GGCTTTCTGCAGAATGGAGATGG - Intronic
1090862503 11:130666523-130666545 GGTTTTCTGCATCCCAGAGAAGG - Intergenic
1091433444 12:455300-455322 GCCTTCCTCCTTCAGGGAGAAGG - Intergenic
1091702715 12:2674465-2674487 GGCTTCCTACCTTACGCAGAGGG + Intronic
1095837268 12:46652446-46652468 GGCATCATGCATGACTGAGAAGG + Intergenic
1096521455 12:52186956-52186978 GGCTTCCTGCAGGAGGGAGCTGG - Intronic
1096573346 12:52537431-52537453 GGGTGCCTACATCACAGAGAGGG + Intergenic
1096629203 12:52914847-52914869 CCCTTCCTGCAGCAGGGAGATGG - Intronic
1103326830 12:120127205-120127227 AGCTTCCTGCATCAGGAATAAGG - Exonic
1104015692 12:124960240-124960262 GGCTCCCTGCCTCAGGGAAAGGG + Intronic
1108363785 13:49691125-49691147 GACTTCCTGCAGCAGGGGGAGGG + Intronic
1109426074 13:62167811-62167833 GGCTTCCTGCTCCATGGAGCTGG + Intergenic
1110852438 13:80261068-80261090 GTGCTGCTGCATCACGGAGATGG + Intergenic
1120730111 14:87992619-87992641 GGCTGTCTTCATCGCGGAGATGG - Intronic
1122780893 14:104142974-104142996 GGTTCCCTGCTTCAAGGAGAGGG + Intronic
1124001917 15:25767242-25767264 GGCTTCCTGCAGAGAGGAGATGG + Intronic
1124428944 15:29589500-29589522 GTCTTCATTCGTCACGGAGAAGG + Intergenic
1124459278 15:29874221-29874243 GGCTTCCTCTATCCCTGAGAAGG + Intronic
1126436758 15:48645297-48645319 GGCTTCCAGCCTGGCGGAGAGGG - Intronic
1129784926 15:78303887-78303909 GGCCTCCTGCTTTACGGAGCAGG + Intergenic
1132305231 15:100807353-100807375 GGCCTCCTGCTTCATGGAGCAGG + Intergenic
1132971819 16:2692952-2692974 GGCTTCCCGCTCCACGGAGCAGG - Intronic
1134270517 16:12729079-12729101 GGCTTCCTCCAGCACAGAGATGG - Intronic
1136469839 16:30472843-30472865 GGATTCCTGCATCACTGTGATGG + Exonic
1143337969 17:6187815-6187837 GGCTTCCTGCATAGCAGACAGGG - Intergenic
1144636253 17:16911124-16911146 GCCTCCCAGCATCACTGAGAAGG - Intergenic
1144739566 17:17574033-17574055 GGCTTCTGGCATCACAGAGCTGG + Intronic
1146005796 17:29159818-29159840 GGTTGCCTGCATCTGGGAGAAGG - Intronic
1147019412 17:37519400-37519422 GGCTTCCTTCAGCACAGTGAGGG - Intronic
1147123743 17:38352042-38352064 GGCCTCCTGCATCGGGGAGAGGG - Intergenic
1148469655 17:47885209-47885231 GGCTTGCAGCACCACGGAGAGGG + Intergenic
1149356507 17:55845373-55845395 GCCTGGCTGCACCACGGAGACGG - Intergenic
1149992698 17:61391727-61391749 GGCTTCCCGCAGCAGGGAGACGG + Intronic
1150637018 17:66920126-66920148 GCCTTCCTCCTTCAGGGAGAAGG - Intergenic
1151916064 17:77118901-77118923 GGCTTCCTTCATCCCGCTGAAGG - Intronic
1153265928 18:3269430-3269452 GGCTTGGTTCATCAGGGAGAGGG + Intronic
1156298935 18:35818278-35818300 GGCCTCCTGCAACACGGAGTGGG - Intergenic
1157955230 18:52089558-52089580 GGCCTGCTGCTTCAGGGAGATGG - Intergenic
1158548456 18:58415369-58415391 AGCTTCCTGAATCACTGAGAGGG + Intergenic
1160303574 18:77708992-77709014 GCCTGCCTGCATTACTGAGAGGG + Intergenic
1162363052 19:10231070-10231092 GGGTTCCTGCTGCACGGAGCGGG - Intronic
1162930116 19:13953357-13953379 AGCTACCAGCCTCACGGAGAAGG - Intronic
1165957082 19:39507669-39507691 GGCCAACTGCACCACGGAGATGG - Intronic
925590727 2:5507178-5507200 GCCTTCCTGCAACAAGGACAGGG + Intergenic
928231315 2:29500978-29501000 TGCTTCCTGCATTGCTGAGAAGG + Intronic
929014449 2:37481164-37481186 GGCTGCATGCATCACAGAGCTGG + Intergenic
940393328 2:153158977-153158999 GGCTGCCTTCTTCAGGGAGAGGG - Intergenic
941663179 2:168216271-168216293 GGCTTCCTGTCTCCCAGAGAAGG + Intronic
943430280 2:187791370-187791392 AACTTCCTGAATCACTGAGAAGG + Intergenic
943689937 2:190859454-190859476 GCCTTCCTGGATCAGGGAGAGGG - Intergenic
946306917 2:218861222-218861244 GGCTCTCCGCATCACGGAGTAGG - Intronic
949056385 2:241930142-241930164 GGCTTCCTGGGTTAAGGAGATGG + Intergenic
1171232305 20:23497297-23497319 GACTTCCTGCAACACAGAGGAGG + Intergenic
1172130680 20:32652795-32652817 GGCTTCCACCATCTCTGAGAGGG - Intergenic
1172587899 20:36097671-36097693 GGCTTCCTGGAGGACAGAGATGG + Intronic
1172967178 20:38845166-38845188 GGCTTCCTCAGGCACGGAGAGGG + Intronic
1175300966 20:57942405-57942427 GGATTCCTGCATCCTGGGGAAGG + Intergenic
1180107603 21:45630218-45630240 GGCTTCGAACATCATGGAGATGG - Intergenic
1185097677 22:48820654-48820676 GGCTGCCTGCACCACGGTGGGGG + Intronic
949169020 3:976602-976624 GCCTTCCTGCAAAACGGAGTAGG - Intergenic
950709829 3:14806142-14806164 TGCTTCCTGCCCCACGCAGAAGG - Intergenic
952269481 3:31817496-31817518 GGCCTCCTGCTCCACGGAGCAGG - Intronic
952712254 3:36443504-36443526 GGCTTCCTGGAGCAGGGAGTGGG - Exonic
954099491 3:48358285-48358307 GGCTTCCAGCTCCACGGAGCAGG - Intergenic
966486335 3:180475033-180475055 GGCTTCCTTTATCACAAAGAAGG + Intergenic
971675234 4:29618008-29618030 GGCTTCCTGAATAACAAAGAAGG + Intergenic
976139218 4:81972710-81972732 GGCTTCCTGCAGGGCAGAGAAGG + Intronic
981469046 4:145108664-145108686 GGCCTACTGCAGCAGGGAGAAGG + Intronic
983673000 4:170259855-170259877 GCCTTCCTGAAGCACTGAGATGG + Intergenic
985768477 5:1794627-1794649 GGCTTCCTGGCTCACAGACAGGG + Intergenic
986052754 5:4105296-4105318 GGCTGCCTGCCTCAAGAAGAAGG + Intergenic
987504534 5:18750861-18750883 GACTTCCTCCATCATGGAAAGGG + Intergenic
991625949 5:68601257-68601279 GACTTCCTGCAACACTTAGATGG - Intergenic
995395084 5:111678745-111678767 GGGTTCCTGGAGCACAGAGAAGG - Intronic
997367228 5:133333774-133333796 GGCCTCCTGCATCAGGCAGAGGG + Intronic
997408690 5:133673309-133673331 AGCTTCCTGCATCATGGAGAAGG - Intergenic
998038161 5:138933812-138933834 GGCTGCCTGGATCAGGGACATGG - Exonic
998792191 5:145777716-145777738 GGCCTCCTGCTCCACGGAGCAGG + Intronic
1001723649 5:173877649-173877671 GACTTCTTGCAGCATGGAGAAGG + Intergenic
1003071110 6:2946346-2946368 TGCTTCCAGCATCACGGAGAGGG - Intergenic
1007933586 6:45713990-45714012 GGCTTTCTGCAGCACTGGGAGGG - Intergenic
1018497363 6:164362804-164362826 AACTTCCTACATCAAGGAGAGGG + Intergenic
1019263181 7:93803-93825 GGCTTCCTGCAGGACGGGAACGG - Intergenic
1019285035 7:219145-219167 GGCTTCCTGCATCACGGAGAAGG - Intronic
1019669704 7:2270816-2270838 GTCTTCCTGCAGCAGGGACAAGG + Intronic
1024752580 7:52485413-52485435 GGCTTGCTGTATTACAGAGAAGG + Intergenic
1029598069 7:101548255-101548277 GGCTCCCTGCACCACAGGGAGGG + Intronic
1034636880 7:152574712-152574734 GCATTCCTGCATCAGGGAGAAGG + Intergenic
1036927314 8:12919647-12919669 GGCATCCTTCATGACGGACACGG - Intergenic
1039965150 8:42278623-42278645 GTCTGCCTGCATCACTGGGACGG - Intronic
1042191451 8:66191675-66191697 GACTTCCTGCAACAAGGAGATGG + Intergenic
1043473681 8:80585403-80585425 GGCTTCCTGGATGACTCAGATGG + Intergenic
1043473703 8:80585657-80585679 GGATTTCTGCAGCAGGGAGATGG - Intergenic
1047599090 8:126408601-126408623 GGCTTTCTTCATAAGGGAGAAGG + Intergenic
1048134161 8:131729910-131729932 GGCTTCCTGTATCACATAGAAGG + Intergenic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1052633669 9:31072063-31072085 GGCTTCCTGCTCCGCGGAGCAGG - Intergenic
1053472916 9:38359635-38359657 GGCTTCCTGAAGCACTGGGATGG + Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1187698023 X:21940633-21940655 GGCTTCCTCCCTCCCGGAGCGGG + Exonic
1189580345 X:42399521-42399543 GGTTTCATGCCTGACGGAGATGG + Intergenic
1195550818 X:106168238-106168260 TGCTTTCCCCATCACGGAGAGGG + Intergenic
1195748781 X:108144340-108144362 GGCTTCTTCCATCACGGAAAGGG - Intronic
1196723775 X:118878127-118878149 GGCCTTCTGCATCAGGGAAATGG + Intergenic
1198875469 X:141220897-141220919 GGTTTCCTGCATCACACAGGTGG + Intergenic
1199360154 X:146907721-146907743 GGCCTCCTGCTCCACAGAGAAGG - Intergenic