ID: 1019287907

View in Genome Browser
Species Human (GRCh38)
Location 7:232794-232816
Sequence GCAGGACGGGGCACCCGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 212}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019287902_1019287907 -6 Left 1019287902 7:232777-232799 CCGGGATCGTGTGCGTTGCAGGA 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1019287907 7:232794-232816 GCAGGACGGGGCACCCGGCGTGG 0: 1
1: 0
2: 2
3: 11
4: 212
1019287900_1019287907 -1 Left 1019287900 7:232772-232794 CCGTGCCGGGATCGTGTGCGTTG No data
Right 1019287907 7:232794-232816 GCAGGACGGGGCACCCGGCGTGG 0: 1
1: 0
2: 2
3: 11
4: 212
1019287897_1019287907 7 Left 1019287897 7:232764-232786 CCCCTCGGCCGTGCCGGGATCGT No data
Right 1019287907 7:232794-232816 GCAGGACGGGGCACCCGGCGTGG 0: 1
1: 0
2: 2
3: 11
4: 212
1019287899_1019287907 5 Left 1019287899 7:232766-232788 CCTCGGCCGTGCCGGGATCGTGT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1019287907 7:232794-232816 GCAGGACGGGGCACCCGGCGTGG 0: 1
1: 0
2: 2
3: 11
4: 212
1019287893_1019287907 21 Left 1019287893 7:232750-232772 CCGCGGCTGACCGGCCCCTCGGC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1019287907 7:232794-232816 GCAGGACGGGGCACCCGGCGTGG 0: 1
1: 0
2: 2
3: 11
4: 212
1019287896_1019287907 11 Left 1019287896 7:232760-232782 CCGGCCCCTCGGCCGTGCCGGGA No data
Right 1019287907 7:232794-232816 GCAGGACGGGGCACCCGGCGTGG 0: 1
1: 0
2: 2
3: 11
4: 212
1019287891_1019287907 28 Left 1019287891 7:232743-232765 CCTAGCGCCGCGGCTGACCGGCC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1019287907 7:232794-232816 GCAGGACGGGGCACCCGGCGTGG 0: 1
1: 0
2: 2
3: 11
4: 212
1019287898_1019287907 6 Left 1019287898 7:232765-232787 CCCTCGGCCGTGCCGGGATCGTG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1019287907 7:232794-232816 GCAGGACGGGGCACCCGGCGTGG 0: 1
1: 0
2: 2
3: 11
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019287907 Original CRISPR GCAGGACGGGGCACCCGGCG TGG Intronic