ID: 1019288629

View in Genome Browser
Species Human (GRCh38)
Location 7:236254-236276
Sequence CGTCCTCGGCGGAGACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019288629_1019288638 8 Left 1019288629 7:236254-236276 CCTGCTGGTCTCCGCCGAGGACG 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1019288638 7:236285-236307 CTCTCAACCTTGCAGGTGCAGGG No data
1019288629_1019288637 7 Left 1019288629 7:236254-236276 CCTGCTGGTCTCCGCCGAGGACG 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1019288637 7:236284-236306 CCTCTCAACCTTGCAGGTGCAGG No data
1019288629_1019288634 1 Left 1019288629 7:236254-236276 CCTGCTGGTCTCCGCCGAGGACG 0: 1
1: 0
2: 1
3: 7
4: 66
Right 1019288634 7:236278-236300 CCCTCTCCTCTCAACCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019288629 Original CRISPR CGTCCTCGGCGGAGACCAGC AGG (reversed) Intronic
900389721 1:2428706-2428728 CGTCCCAGCCGGAGACCGGCAGG - Intronic
901019794 1:6249829-6249851 CGTCCTCCGCGAAGGCCAGGAGG + Exonic
901157392 1:7149751-7149773 CGGCCTGGGCGGCGGCCAGCAGG + Intronic
901361386 1:8703495-8703517 CGCCCGCGGCGGCGGCCAGCAGG - Intronic
901438598 1:9264152-9264174 CGGACCAGGCGGAGACCAGCGGG - Exonic
906315965 1:44786583-44786605 CGTGCACGGCGTGGACCAGCGGG - Exonic
910731262 1:90399893-90399915 CATGCTCGGCTGGGACCAGCTGG + Intergenic
915128141 1:153679756-153679778 CGTCCTCGGCGAACTCCAGGTGG - Exonic
924624820 1:245689024-245689046 TGTCCCCGGCGGAGCCCCGCGGG - Intronic
1072849961 10:98879465-98879487 CGTCCTCACCAGACACCAGCTGG - Intronic
1072915645 10:99535946-99535968 CGTCCTCCCCGGCGCCCAGCCGG - Exonic
1075632650 10:124010567-124010589 CACCCTCGGGGGAGCCCAGCTGG + Intronic
1077225823 11:1438732-1438754 CGTCCTGGGCAGAGGCCAGGAGG - Intronic
1077230700 11:1457094-1457116 GGTCCTCGGCGGAGCCAGGCTGG + Intronic
1078901903 11:15650153-15650175 CGTCCGCAGCGGAGAACTGCAGG - Intergenic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083911649 11:65713349-65713371 CGGCCTCGGCGCAGGCCAGCGGG + Exonic
1084086669 11:66858119-66858141 CATCCTCAGCGGCAACCAGCTGG + Exonic
1085037929 11:73310745-73310767 CGTCGTCGGCGGAGGGCACCTGG - Exonic
1092109534 12:5949120-5949142 CGTCCGTGTCGGAGAGCAGCAGG + Exonic
1104602401 12:130162499-130162521 CGGCCTCGGCCGGGACCAGCCGG - Exonic
1112723109 13:102269178-102269200 AGTCCTAGGTGGAGACCAACTGG + Intronic
1113201219 13:107868317-107868339 GGTCCTCGGAGGAGCCCACCCGG - Intergenic
1121026043 14:90616772-90616794 CGTGGTCTGCAGAGACCAGCAGG - Intronic
1128398625 15:67254565-67254587 CGTCTTCTCAGGAGACCAGCTGG - Exonic
1132763691 16:1523899-1523921 TGTCCTCGGGGGAGCTCAGCAGG + Exonic
1136283747 16:29229622-29229644 CCTCCTCGTAGGAAACCAGCAGG - Intergenic
1139530102 16:67538521-67538543 CGTCCTCGGCAGCCACGAGCGGG + Exonic
1140042237 16:71415823-71415845 AGTCCTGGGTGGAAACCAGCAGG - Intergenic
1141957919 16:87384531-87384553 CGGCCTCGGCGGAGCCCAGCTGG - Intronic
1142088779 16:88199133-88199155 CCTCCTCGTAGGAAACCAGCAGG - Intergenic
1147393311 17:40122783-40122805 CGCCCTGGGAGGAGGCCAGCGGG - Intronic
1147598538 17:41732232-41732254 CCTCCTTGGCTGAGCCCAGCAGG + Exonic
1148486081 17:47991680-47991702 TGTCCTCGGGGGAGGTCAGCCGG - Intergenic
1152046603 17:77940786-77940808 CGTGCTTGGCACAGACCAGCTGG - Intergenic
1153387063 18:4510393-4510415 GGTCCTAGGCAGAGACCAGCTGG + Intergenic
1160609176 18:80072914-80072936 CCTCCTGGGAGGTGACCAGCAGG - Intronic
1160858532 19:1227932-1227954 CGGCCCCGCCGCAGACCAGCTGG + Exonic
1163837573 19:19584393-19584415 CCTCCTCGGCTCAGACCAGCAGG + Intronic
1165787934 19:38473550-38473572 CGTCCTCGGCGGGGGGCTGCAGG - Exonic
928025460 2:27735657-27735679 CGGGCGCGGGGGAGACCAGCAGG + Intergenic
937198359 2:120180238-120180260 CGTCCTGAGGAGAGACCAGCGGG + Intergenic
946422026 2:219570674-219570696 CGTCCTCGGCGCGGCCCGGCTGG + Exonic
948852767 2:240716493-240716515 TGTCCTGGGCGGGGACCAGGAGG - Exonic
1171121870 20:22575579-22575601 TGTCCTCAGCGGAGCTCAGCAGG - Intergenic
1172658317 20:36550011-36550033 TGTGCTCAGCTGAGACCAGCAGG + Exonic
1175941277 20:62538623-62538645 CATCCTCCTCGGAGACCAGCAGG + Intergenic
1176548996 21:8213504-8213526 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1176567925 21:8396534-8396556 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1176575829 21:8440753-8440775 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1179461712 21:41539798-41539820 GGTCCTGGACGGAGACCAGCAGG + Intergenic
1183264453 22:36816808-36816830 CGACCTCGCCGGCGCCCAGCGGG + Intronic
1183290948 22:37001836-37001858 CCTGCTCCTCGGAGACCAGCTGG + Exonic
1185070389 22:48652761-48652783 AGTACGCGACGGAGACCAGCTGG + Intronic
1203253880 22_KI270733v1_random:129811-129833 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1203261936 22_KI270733v1_random:174890-174912 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
951538529 3:23761328-23761350 CTTCTTCTGAGGAGACCAGCTGG + Intergenic
952905458 3:38136924-38136946 CGTCCGCGGCCGAGGCCTGCGGG + Exonic
967915278 3:194573783-194573805 CCTCCTCGTGGGACACCAGCTGG - Intergenic
990763421 5:59155793-59155815 CGTCATCCGCTGAGACCAGAAGG + Intronic
1019288629 7:236254-236276 CGTCCTCGGCGGAGACCAGCAGG - Intronic
1019388878 7:774214-774236 CGTGCTCGGTGGACACCGGCCGG + Intronic
1040563885 8:48548827-48548849 TGTCCTCAGCAGAGAACAGCAGG - Intergenic
1042127893 8:65557443-65557465 TGTCCTCCGAGGATACCAGCAGG - Intergenic
1047249610 8:123171759-123171781 AGTTCTCTGCAGAGACCAGCTGG - Intergenic
1048443809 8:134478610-134478632 CGTCGTCGGAGGACACCACCAGG + Exonic
1049803372 8:144528339-144528361 CCTCCTCCGCGGAGACTACCTGG + Intronic
1057096490 9:92315018-92315040 CGGCCTCTGCGGAGGCCAGTGGG + Exonic
1059398745 9:114055238-114055260 GGTCCTAGGCGGAGACCGGCTGG - Exonic
1059942150 9:119369070-119369092 CGTCTTTGGCGGAGAGCTGCGGG + Exonic
1060560446 9:124538129-124538151 GGTCCTCGGCTGATAACAGCTGG + Exonic
1061007767 9:127937936-127937958 CCACCTCGTCGGAGACGAGCAGG + Exonic
1062255274 9:135617862-135617884 CCTCCTCTGCGGAGAACAACGGG - Intergenic
1203470280 Un_GL000220v1:112955-112977 TGTCCCCGGCGGCGACCCGCGGG + Intergenic
1203478101 Un_GL000220v1:156927-156949 TGTCCCCGGCGGCGACCCGCGGG + Intergenic