ID: 1019289272

View in Genome Browser
Species Human (GRCh38)
Location 7:242438-242460
Sequence CTGAGAAAGCAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019289267_1019289272 -8 Left 1019289267 7:242423-242445 CCAGGACAGTCCTGACTGAGAAA 0: 1
1: 0
2: 0
3: 13
4: 188
Right 1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG No data
1019289266_1019289272 6 Left 1019289266 7:242409-242431 CCTGGAGGCGGTGGCCAGGACAG 0: 1
1: 0
2: 4
3: 32
4: 372
Right 1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG No data
1019289262_1019289272 18 Left 1019289262 7:242397-242419 CCAGAGGGTCTTCCTGGAGGCGG 0: 2
1: 0
2: 2
3: 46
4: 322
Right 1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019289272 Original CRISPR CTGAGAAAGCAGAAGGAGGA GGG Intronic
No off target data available for this crispr