ID: 1019290614

View in Genome Browser
Species Human (GRCh38)
Location 7:248351-248373
Sequence CAGGATGGTCAACATGACCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019290608_1019290614 -8 Left 1019290608 7:248336-248358 CCCTCCCGTGGCCGGCAGGATGG 0: 1
1: 0
2: 3
3: 13
4: 129
Right 1019290614 7:248351-248373 CAGGATGGTCAACATGACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 137
1019290599_1019290614 17 Left 1019290599 7:248311-248333 CCAGGATCCTGGACTTCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1019290614 7:248351-248373 CAGGATGGTCAACATGACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 137
1019290596_1019290614 28 Left 1019290596 7:248300-248322 CCCGTTTCTTGCCAGGATCCTGG 0: 1
1: 0
2: 3
3: 24
4: 245
Right 1019290614 7:248351-248373 CAGGATGGTCAACATGACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 137
1019290598_1019290614 27 Left 1019290598 7:248301-248323 CCGTTTCTTGCCAGGATCCTGGA 0: 1
1: 0
2: 1
3: 21
4: 240
Right 1019290614 7:248351-248373 CAGGATGGTCAACATGACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 137
1019290604_1019290614 1 Left 1019290604 7:248327-248349 CCGCCGGGTCCCTCCCGTGGCCG 0: 1
1: 0
2: 2
3: 35
4: 478
Right 1019290614 7:248351-248373 CAGGATGGTCAACATGACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 137
1019290606_1019290614 -2 Left 1019290606 7:248330-248352 CCGGGTCCCTCCCGTGGCCGGCA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1019290614 7:248351-248373 CAGGATGGTCAACATGACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 137
1019290602_1019290614 10 Left 1019290602 7:248318-248340 CCTGGACTTCCGCCGGGTCCCTC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1019290614 7:248351-248373 CAGGATGGTCAACATGACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 137
1019290610_1019290614 -9 Left 1019290610 7:248337-248359 CCTCCCGTGGCCGGCAGGATGGT 0: 1
1: 0
2: 2
3: 6
4: 80
Right 1019290614 7:248351-248373 CAGGATGGTCAACATGACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019290614 Original CRISPR CAGGATGGTCAACATGACCA AGG Exonic
901936388 1:12629963-12629985 CAGGGTGGTAAACATGCCAAGGG - Intergenic
902218640 1:14950499-14950521 CAGGATGGCCAACAGAAACATGG + Intronic
902557661 1:17256494-17256516 CAGGAGGGTCCCCAGGACCACGG - Intronic
908249519 1:62254091-62254113 CAGGAGGGTGAACAACACCATGG + Intronic
908450073 1:64245622-64245644 CAGGATGGCCAACATGAATTAGG - Intronic
915326206 1:155082375-155082397 CAGGGTGTCCAACAAGACCAGGG - Intronic
915640258 1:157219221-157219243 CAGGAGGGTCAGCATCACCTGGG + Intergenic
917208170 1:172600227-172600249 CAGGCTTGTTAACATGAACATGG + Intronic
921021122 1:211236703-211236725 CAGGATGGACAGCATAAACATGG + Intergenic
921577385 1:216852319-216852341 CAAGATGGTGAACACAACCAAGG + Intronic
922536733 1:226386510-226386532 CTGGAGGCTCAGCATGACCAGGG - Intronic
923218961 1:231875696-231875718 CAGGAGAGTGAAAATGACCATGG - Intronic
1062769806 10:90396-90418 CAGGAAGCACATCATGACCAAGG - Intergenic
1064228010 10:13504397-13504419 CAGGATTTTCACCATCACCAAGG + Intronic
1069558932 10:69416147-69416169 CAGGATGATCCAGATGACGATGG + Exonic
1072864165 10:99041347-99041369 CAGGATTGTCAGCAGAACCAGGG + Intronic
1076025636 10:127110280-127110302 CTGGATGGTCAGCAAGCCCATGG - Exonic
1077531430 11:3097731-3097753 AAGGATTGGAAACATGACCAAGG + Intronic
1080607402 11:33875093-33875115 GAGGTTGGGCAACATGCCCAAGG - Intronic
1084275622 11:68049694-68049716 CAGGATGGGCACCATGGCCAAGG - Exonic
1084407181 11:68980870-68980892 CAGGCAGGTGAACATGGCCAGGG + Exonic
1087104297 11:94394852-94394874 TAACATGGTCAACATGAGCAAGG + Intronic
1088293781 11:108269781-108269803 AAGGGTGGGAAACATGACCAGGG - Intronic
1088851735 11:113708880-113708902 CAGGAGGGTGCACATGCCCAGGG + Intergenic
1090085184 11:123644349-123644371 AAGGATGACCAACATGTCCAAGG + Intronic
1091275867 11:134349679-134349701 AAAGATGCTCAACATCACCAGGG - Intronic
1091504497 12:1053270-1053292 CAGGACTGTCAACTTGACTATGG + Intronic
1095120890 12:38417305-38417327 CAGGATGGAGCAGATGACCAGGG - Intergenic
1095250593 12:39974379-39974401 CAGGATGGTTAGCAAGAACATGG - Intronic
1098591542 12:72219730-72219752 CAAGATGGACAAAAGGACCATGG - Intronic
1099151363 12:79118038-79118060 CAGGGAGGTCAAAAGGACCAAGG - Intronic
1100212865 12:92416306-92416328 CAGGATGTATAACATAACCATGG + Intergenic
1102012163 12:109625548-109625570 CAGGAGGGTGGACAAGACCACGG - Intergenic
1104290823 12:127465125-127465147 CAGGGTGGGTCACATGACCATGG + Intergenic
1106022556 13:25929303-25929325 CAGGATGGTCACTATGGCAACGG - Intronic
1106888389 13:34215749-34215771 CAGGCAGGTCACCAGGACCACGG - Intergenic
1108095408 13:46895499-46895521 CAGGATGGTTAACATGGACACGG + Exonic
1108635715 13:52332964-52332986 CAGCCTGGGCAACATGACGAAGG + Intergenic
1108652092 13:52490284-52490306 CAGCCTGGGCAACATGACGAAGG - Intergenic
1111728749 13:92045543-92045565 CATGATTGTCACCATCACCATGG + Intronic
1114408483 14:22478459-22478481 GGGGTTGGTCAACAGGACCACGG + Intergenic
1114531435 14:23399014-23399036 CAGGATGGACATGATGCCCATGG + Exonic
1114536768 14:23427871-23427893 CAGGATGGACATGATGCCCATGG + Exonic
1114723384 14:24907905-24907927 CTGGATGGTTAAGATGACCCAGG - Intronic
1116957658 14:50941555-50941577 CTGGATTGTCAAGATGACAATGG + Intronic
1118373293 14:65156021-65156043 CAGCATTGTCAACATTCCCATGG - Intergenic
1120962246 14:90136040-90136062 CAGTATGGTGGACAAGACCAGGG + Intronic
1122876835 14:104671171-104671193 CAGACTGGTCAATATGAACAAGG + Intergenic
1123399583 15:19971244-19971266 CATGATGTGCATCATGACCAAGG + Intergenic
1124601457 15:31136111-31136133 GGAGATGGCCAACATGACCATGG - Intronic
1125687538 15:41572485-41572507 CATGAAGGGCAAGATGACCATGG - Exonic
1128807243 15:70540152-70540174 CAGGATGGCTAACGAGACCATGG - Intergenic
1129530317 15:76259882-76259904 CATGAAGGGCAAGATGACCACGG + Intronic
1129766629 15:78173665-78173687 CCGGAGGGTCAACATGAACGCGG - Exonic
1132370585 15:101295160-101295182 CAGGATGGTCAAGCTGACGGCGG - Exonic
1134812089 16:17176432-17176454 CAGGTTGAGCAACATGCCCAAGG + Intronic
1139641325 16:68293850-68293872 CAGCATGGTCAGCATCACCTTGG - Intronic
1141282824 16:82644454-82644476 CAGCATTTTCAACATGACAAAGG - Intronic
1141980687 16:87548164-87548186 CACCATGGTCAACAAGAGCATGG - Intergenic
1144950296 17:18990286-18990308 CAGGCAGGTCACCATGACCCTGG + Intronic
1146314377 17:31795663-31795685 CAGGAAGGTAAGCATGACCTGGG - Intergenic
1158204472 18:54976516-54976538 CAGGAGGCTCAACATGATCCTGG - Intergenic
1159274895 18:66206107-66206129 CAGGGTAGGCAACTTGACCAAGG - Intergenic
1160565186 18:79782701-79782723 CAGGCAGGTCAACCTGACCACGG - Intergenic
1164575272 19:29402089-29402111 GAGGAAGGCCAAAATGACCAAGG - Intergenic
1164794596 19:31015607-31015629 CAGAAGGGGCAACATGACCAGGG + Intergenic
1166069767 19:40380331-40380353 CAACATTGACAACATGACCATGG - Exonic
1167150098 19:47703406-47703428 CAGGGGGTTCAACATGAACAAGG + Intergenic
1167659173 19:50785966-50785988 CAGGATGGTGAACAAGGCCATGG + Intergenic
1167941738 19:52952453-52952475 CAGAATGGTCAGCATGGCCCAGG - Intronic
1168669621 19:58230704-58230726 CAGGATGGGCAAGATGAGGAGGG + Intronic
925553950 2:5107840-5107862 CAGGAAGGGGAACATCACCAGGG - Intergenic
925727554 2:6888470-6888492 CAGGAAAGTCAACATGTCTAAGG - Intronic
929879034 2:45820825-45820847 CACTAAGGTCAACATGACCCAGG - Intronic
933651313 2:84852472-84852494 GAGGATGGCCAAAATGACCATGG + Intronic
934577995 2:95415040-95415062 GAGGATGGACAGAATGACCAAGG - Exonic
934601443 2:95661662-95661684 GAGGATGGACAGAATGACCAAGG + Intergenic
936576231 2:113657904-113657926 CAGGATGGTCAAGCTGACGGCGG + Intergenic
938365375 2:130729354-130729376 CAGGATGGTCACCAGCAGCAGGG - Exonic
938692935 2:133808882-133808904 CAGCCTGGTCAACAAGAACAGGG + Intergenic
941753609 2:169161408-169161430 AAGGATGATGAACATAACCAAGG - Intronic
945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG + Intergenic
1168934913 20:1656724-1656746 GAGGAAAGTCAAGATGACCAAGG + Intronic
1169108508 20:3017876-3017898 CAGGTTGGTAACCATGACGATGG - Exonic
1170760792 20:19249472-19249494 CAGGAGTGTCAACATCCCCACGG + Intronic
1174791197 20:53480041-53480063 CAGCATGGACAACATAACCCAGG + Intronic
1175515328 20:59566353-59566375 AGGGGTGGTCAACATGGCCATGG - Intergenic
1179584582 21:42366442-42366464 CAGCATGGACACCAGGACCAGGG + Exonic
1180258191 21:46648734-46648756 CAGGGTGCTCAACAAGACCATGG - Intronic
1181914450 22:26268398-26268420 AAGGAGGGGCAACATGACCAAGG + Intronic
1184568453 22:45307759-45307781 CAGAATGGTCAAGGTGCCCAGGG + Intergenic
1184808144 22:46809599-46809621 CAGTATGGGAAACAGGACCATGG + Intronic
1185424174 22:50755415-50755437 CAGGATGGTCAAGCTGACGGCGG - Intergenic
952559856 3:34578963-34578985 CAGGATCATAAACATGACTATGG - Intergenic
953746241 3:45576106-45576128 CAAGATGGTCACCACGGCCAGGG + Intronic
954444702 3:50540443-50540465 CAGCATGGTGAACAAGGCCAGGG - Intergenic
954741028 3:52750730-52750752 CAGCCTGGGCAACATGGCCATGG + Intronic
958728511 3:97935344-97935366 GAGGCAGGTCAGCATGACCACGG - Intronic
960521106 3:118656433-118656455 CAGATTAGTCATCATGACCAAGG - Intergenic
961575604 3:127833553-127833575 CAGGCTGGTTTACATGACAAAGG - Intergenic
965768115 3:172153037-172153059 CAGGATGGAAAACCTGACCCAGG - Intronic
966047888 3:175575311-175575333 CAGGCTGGGCAACAAGAGCAAGG - Intronic
967153960 3:186675836-186675858 CAGGATTGTCACCATGAACATGG + Intronic
969469978 4:7381986-7382008 CAGGCAGGTGAACAGGACCAGGG + Intronic
971176994 4:24291673-24291695 CAGGCTGGTCAAGAAGAGCACGG - Intergenic
972979506 4:44678615-44678637 CACGAGGGTCCACATGACCCGGG - Exonic
981156085 4:141438033-141438055 CAGAATGGTCAAAATGTCCATGG - Intergenic
983156751 4:164357211-164357233 CAGCAAGTTAAACATGACCAGGG + Intronic
989236073 5:39149894-39149916 AAGGCTGGTTAAGATGACCAAGG - Intronic
995760433 5:115556199-115556221 CAGGATAGAAAACAAGACCAAGG - Intergenic
996147595 5:119994827-119994849 CAGGAGGGCCAACATGGCTAGGG + Intergenic
998489029 5:142529786-142529808 CAGGTTGTTCAACAAGACCAAGG + Intergenic
999576586 5:152985090-152985112 CAGGGTGGTTATCCTGACCAAGG + Intergenic
1001499423 5:172217685-172217707 CAGCCTGGACAACATGAACATGG - Intronic
1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG + Intergenic
1003625748 6:7739833-7739855 AAGCATCGTCAACATGATCAAGG - Intronic
1007342165 6:41198208-41198230 CAAGGTGGTCAACATCACCATGG - Exonic
1007348282 6:41249529-41249551 CAAGGTGGTCAACATCACCATGG + Intergenic
1011424695 6:87213656-87213678 CAGGATGGACCAGGTGACCAGGG + Intronic
1011513324 6:88125397-88125419 CAGGATGGACCAGGTGACCAGGG + Intergenic
1014591993 6:123285062-123285084 CAGTATTGTGAAAATGACCAGGG + Intronic
1016047937 6:139499640-139499662 CAATATGGTAAACATCACCATGG - Intergenic
1016942362 6:149493428-149493450 CAGTATCTTCAGCATGACCAGGG - Intergenic
1017126519 6:151069662-151069684 CAGGCTGGTAAACAGAACCAAGG - Intronic
1018923072 6:168189219-168189241 CAGGATGGGCTTCCTGACCAGGG - Intergenic
1019022895 6:168933231-168933253 CAGGATACTCAACTTTACCAGGG - Intergenic
1019290614 7:248351-248373 CAGGATGGTCAACATGACCAAGG + Exonic
1019593188 7:1845991-1846013 CAGGATGGTGCCCGTGACCAGGG + Intronic
1020644566 7:10799045-10799067 CAGGATGGCCAGAATGACAAGGG + Intergenic
1021800180 7:24297030-24297052 CAGGAAGGTAAACATGATGATGG + Intergenic
1022443578 7:30452466-30452488 CAGGTTGGCCAGCAAGACCAGGG + Exonic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023822119 7:43986248-43986270 CAGGATGGCGATGATGACCACGG + Intergenic
1024880685 7:54082338-54082360 CAGGAATGTCAACAGAACCAGGG - Intergenic
1027382302 7:77624064-77624086 CAGTCTGGGCAACATGAACATGG + Intronic
1029750385 7:102539662-102539684 CAGGATGGCGATGATGACCACGG + Intronic
1029768337 7:102638770-102638792 CAGGATGGCGATGATGACCACGG + Exonic
1031906615 7:127466865-127466887 CAGGCTGGTCACCATCACCTTGG - Intergenic
1032551629 7:132789813-132789835 CAGGAAGGTCTACCTAACCAAGG + Intronic
1032706231 7:134423100-134423122 CAGGAGGGGCAAGAGGACCACGG - Intergenic
1034358043 7:150469138-150469160 CAGGAAGGCCAGCAGGACCAAGG - Intronic
1037907676 8:22725027-22725049 CAGGGAGGTCAGCAGGACCATGG - Intronic
1038464869 8:27752294-27752316 CAGGACGGTCAAAATGACAAGGG + Intronic
1040467869 8:47712017-47712039 AAGGATGGTCAGCAGGGCCAGGG - Intronic
1046469241 8:114647360-114647382 CAGAATTGTCAACATTCCCATGG + Intergenic
1047903754 8:129451064-129451086 CAGTCTGGTCAACTTGACCTGGG + Intergenic
1049700304 8:144008112-144008134 CCGGAGGTTCAACATGGCCACGG + Intronic
1050157100 9:2679288-2679310 CAGGATCCTCTACATAACCAGGG - Intergenic
1061439470 9:130590581-130590603 CAGGATGGTCCACAAAACCAAGG - Intronic
1186730675 X:12406137-12406159 TAGGATGTTCAACATGTCCCTGG - Intronic
1187458863 X:19467398-19467420 AAGTGTGGTCAAGATGACCAGGG + Intronic
1189253161 X:39616938-39616960 CAGGCTTCTCAACATGTCCAAGG - Intergenic
1192552757 X:72067190-72067212 CAAGAAGTTGAACATGACCAGGG - Intergenic
1196724000 X:118879313-118879335 CGCGGTGCTCAACATGACCATGG + Intergenic
1197964019 X:132036965-132036987 CAGGATGGTCACTATGTTCAAGG + Intergenic