ID: 1019291689

View in Genome Browser
Species Human (GRCh38)
Location 7:253647-253669
Sequence GACCCCCGCTTCCCGGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019291684_1019291689 -2 Left 1019291684 7:253626-253648 CCGTGATGCCGGCGTTGCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1019291689 7:253647-253669 GACCCCCGCTTCCCGGGCGAGGG No data
1019291676_1019291689 26 Left 1019291676 7:253598-253620 CCCGTGGCTTCTTTGTGTAATTC 0: 1
1: 0
2: 2
3: 18
4: 251
Right 1019291689 7:253647-253669 GACCCCCGCTTCCCGGGCGAGGG No data
1019291680_1019291689 3 Left 1019291680 7:253621-253643 CCAGCCCGTGATGCCGGCGTTGC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1019291689 7:253647-253669 GACCCCCGCTTCCCGGGCGAGGG No data
1019291685_1019291689 -10 Left 1019291685 7:253634-253656 CCGGCGTTGCTGGGACCCCCGCT 0: 1
1: 0
2: 0
3: 12
4: 309
Right 1019291689 7:253647-253669 GACCCCCGCTTCCCGGGCGAGGG No data
1019291679_1019291689 4 Left 1019291679 7:253620-253642 CCCAGCCCGTGATGCCGGCGTTG 0: 1
1: 0
2: 0
3: 5
4: 40
Right 1019291689 7:253647-253669 GACCCCCGCTTCCCGGGCGAGGG No data
1019291677_1019291689 25 Left 1019291677 7:253599-253621 CCGTGGCTTCTTTGTGTAATTCC 0: 1
1: 0
2: 0
3: 24
4: 284
Right 1019291689 7:253647-253669 GACCCCCGCTTCCCGGGCGAGGG No data
1019291675_1019291689 29 Left 1019291675 7:253595-253617 CCTCCCGTGGCTTCTTTGTGTAA 0: 1
1: 0
2: 0
3: 4
4: 178
Right 1019291689 7:253647-253669 GACCCCCGCTTCCCGGGCGAGGG No data
1019291682_1019291689 -1 Left 1019291682 7:253625-253647 CCCGTGATGCCGGCGTTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1019291689 7:253647-253669 GACCCCCGCTTCCCGGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019291689 Original CRISPR GACCCCCGCTTCCCGGGCGA GGG Intronic