ID: 1019294434

View in Genome Browser
Species Human (GRCh38)
Location 7:266469-266491
Sequence TGAGTCCCAAAAGGACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019294434_1019294438 4 Left 1019294434 7:266469-266491 CCAGGCTGTCCTTTTGGGACTCA No data
Right 1019294438 7:266496-266518 TCAGCCCTTCCCCACCTCCTGGG No data
1019294434_1019294440 6 Left 1019294434 7:266469-266491 CCAGGCTGTCCTTTTGGGACTCA No data
Right 1019294440 7:266498-266520 AGCCCTTCCCCACCTCCTGGGGG No data
1019294434_1019294441 7 Left 1019294434 7:266469-266491 CCAGGCTGTCCTTTTGGGACTCA No data
Right 1019294441 7:266499-266521 GCCCTTCCCCACCTCCTGGGGGG No data
1019294434_1019294437 3 Left 1019294434 7:266469-266491 CCAGGCTGTCCTTTTGGGACTCA No data
Right 1019294437 7:266495-266517 CTCAGCCCTTCCCCACCTCCTGG No data
1019294434_1019294439 5 Left 1019294434 7:266469-266491 CCAGGCTGTCCTTTTGGGACTCA No data
Right 1019294439 7:266497-266519 CAGCCCTTCCCCACCTCCTGGGG No data
1019294434_1019294447 17 Left 1019294434 7:266469-266491 CCAGGCTGTCCTTTTGGGACTCA No data
Right 1019294447 7:266509-266531 ACCTCCTGGGGGGACCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019294434 Original CRISPR TGAGTCCCAAAAGGACAGCC TGG (reversed) Intergenic
No off target data available for this crispr