ID: 1019296247

View in Genome Browser
Species Human (GRCh38)
Location 7:276833-276855
Sequence GGCTGCACACCCCAGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019296247_1019296256 29 Left 1019296247 7:276833-276855 CCAGCTACCTGGGGTGTGCAGCC No data
Right 1019296256 7:276885-276907 GATGGAGCAGCCACTCACCTTGG No data
1019296247_1019296257 30 Left 1019296247 7:276833-276855 CCAGCTACCTGGGGTGTGCAGCC No data
Right 1019296257 7:276886-276908 ATGGAGCAGCCACTCACCTTGGG No data
1019296247_1019296253 11 Left 1019296247 7:276833-276855 CCAGCTACCTGGGGTGTGCAGCC No data
Right 1019296253 7:276867-276889 GCCTGCTGCAGCCGGTGTGATGG No data
1019296247_1019296251 3 Left 1019296247 7:276833-276855 CCAGCTACCTGGGGTGTGCAGCC No data
Right 1019296251 7:276859-276881 CTGTGCCTGCCTGCTGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019296247 Original CRISPR GGCTGCACACCCCAGGTAGC TGG (reversed) Intergenic
No off target data available for this crispr