ID: 1019296251

View in Genome Browser
Species Human (GRCh38)
Location 7:276859-276881
Sequence CTGTGCCTGCCTGCTGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019296240_1019296251 23 Left 1019296240 7:276813-276835 CCCAGGAGGGAAGGCTCCCACCA No data
Right 1019296251 7:276859-276881 CTGTGCCTGCCTGCTGCAGCCGG No data
1019296245_1019296251 7 Left 1019296245 7:276829-276851 CCCACCAGCTACCTGGGGTGTGC No data
Right 1019296251 7:276859-276881 CTGTGCCTGCCTGCTGCAGCCGG No data
1019296246_1019296251 6 Left 1019296246 7:276830-276852 CCACCAGCTACCTGGGGTGTGCA No data
Right 1019296251 7:276859-276881 CTGTGCCTGCCTGCTGCAGCCGG No data
1019296248_1019296251 -4 Left 1019296248 7:276840-276862 CCTGGGGTGTGCAGCCCAGCTGT No data
Right 1019296251 7:276859-276881 CTGTGCCTGCCTGCTGCAGCCGG No data
1019296247_1019296251 3 Left 1019296247 7:276833-276855 CCAGCTACCTGGGGTGTGCAGCC No data
Right 1019296251 7:276859-276881 CTGTGCCTGCCTGCTGCAGCCGG No data
1019296238_1019296251 27 Left 1019296238 7:276809-276831 CCCACCCAGGAGGGAAGGCTCCC No data
Right 1019296251 7:276859-276881 CTGTGCCTGCCTGCTGCAGCCGG No data
1019296241_1019296251 22 Left 1019296241 7:276814-276836 CCAGGAGGGAAGGCTCCCACCAG No data
Right 1019296251 7:276859-276881 CTGTGCCTGCCTGCTGCAGCCGG No data
1019296237_1019296251 28 Left 1019296237 7:276808-276830 CCCCACCCAGGAGGGAAGGCTCC No data
Right 1019296251 7:276859-276881 CTGTGCCTGCCTGCTGCAGCCGG No data
1019296239_1019296251 26 Left 1019296239 7:276810-276832 CCACCCAGGAGGGAAGGCTCCCA No data
Right 1019296251 7:276859-276881 CTGTGCCTGCCTGCTGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019296251 Original CRISPR CTGTGCCTGCCTGCTGCAGC CGG Intergenic
No off target data available for this crispr