ID: 1019296257

View in Genome Browser
Species Human (GRCh38)
Location 7:276886-276908
Sequence ATGGAGCAGCCACTCACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019296247_1019296257 30 Left 1019296247 7:276833-276855 CCAGCTACCTGGGGTGTGCAGCC No data
Right 1019296257 7:276886-276908 ATGGAGCAGCCACTCACCTTGGG No data
1019296250_1019296257 8 Left 1019296250 7:276855-276877 CCAGCTGTGCCTGCCTGCTGCAG No data
Right 1019296257 7:276886-276908 ATGGAGCAGCCACTCACCTTGGG No data
1019296248_1019296257 23 Left 1019296248 7:276840-276862 CCTGGGGTGTGCAGCCCAGCTGT No data
Right 1019296257 7:276886-276908 ATGGAGCAGCCACTCACCTTGGG No data
1019296249_1019296257 9 Left 1019296249 7:276854-276876 CCCAGCTGTGCCTGCCTGCTGCA No data
Right 1019296257 7:276886-276908 ATGGAGCAGCCACTCACCTTGGG No data
1019296254_1019296257 -5 Left 1019296254 7:276868-276890 CCTGCTGCAGCCGGTGTGATGGA No data
Right 1019296257 7:276886-276908 ATGGAGCAGCCACTCACCTTGGG No data
1019296252_1019296257 -1 Left 1019296252 7:276864-276886 CCTGCCTGCTGCAGCCGGTGTGA No data
Right 1019296257 7:276886-276908 ATGGAGCAGCCACTCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019296257 Original CRISPR ATGGAGCAGCCACTCACCTT GGG Intergenic
No off target data available for this crispr