ID: 1019297409

View in Genome Browser
Species Human (GRCh38)
Location 7:285425-285447
Sequence CTCGGACAGTACCCTAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019297408_1019297409 -10 Left 1019297408 7:285412-285434 CCGCTGAGCGGGGCTCGGACAGT No data
Right 1019297409 7:285425-285447 CTCGGACAGTACCCTAAGCTAGG No data
1019297400_1019297409 18 Left 1019297400 7:285384-285406 CCGATGTGTAGCTTTTATGATCT No data
Right 1019297409 7:285425-285447 CTCGGACAGTACCCTAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019297409 Original CRISPR CTCGGACAGTACCCTAAGCT AGG Intergenic
No off target data available for this crispr