ID: 1019300582

View in Genome Browser
Species Human (GRCh38)
Location 7:301580-301602
Sequence GCCTAGGGCCGTGTGATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019300574_1019300582 19 Left 1019300574 7:301538-301560 CCTCCCCGTGTTACAGACGAGGA No data
Right 1019300582 7:301580-301602 GCCTAGGGCCGTGTGATTTGAGG No data
1019300577_1019300582 14 Left 1019300577 7:301543-301565 CCGTGTTACAGACGAGGAAACTG No data
Right 1019300582 7:301580-301602 GCCTAGGGCCGTGTGATTTGAGG No data
1019300576_1019300582 15 Left 1019300576 7:301542-301564 CCCGTGTTACAGACGAGGAAACT No data
Right 1019300582 7:301580-301602 GCCTAGGGCCGTGTGATTTGAGG No data
1019300575_1019300582 16 Left 1019300575 7:301541-301563 CCCCGTGTTACAGACGAGGAAAC No data
Right 1019300582 7:301580-301602 GCCTAGGGCCGTGTGATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019300582 Original CRISPR GCCTAGGGCCGTGTGATTTG AGG Intergenic
No off target data available for this crispr