ID: 1019301203

View in Genome Browser
Species Human (GRCh38)
Location 7:304369-304391
Sequence GTGGCCGGGCCAGGTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019301203_1019301213 24 Left 1019301203 7:304369-304391 CCTGGATCACCTGGCCCGGCCAC No data
Right 1019301213 7:304416-304438 CCCGTCCTGCACAGGCACCCTGG No data
1019301203_1019301216 26 Left 1019301203 7:304369-304391 CCTGGATCACCTGGCCCGGCCAC No data
Right 1019301216 7:304418-304440 CGTCCTGCACAGGCACCCTGGGG No data
1019301203_1019301215 25 Left 1019301203 7:304369-304391 CCTGGATCACCTGGCCCGGCCAC No data
Right 1019301215 7:304417-304439 CCGTCCTGCACAGGCACCCTGGG No data
1019301203_1019301211 16 Left 1019301203 7:304369-304391 CCTGGATCACCTGGCCCGGCCAC No data
Right 1019301211 7:304408-304430 GTTGAAGTCCCGTCCTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019301203 Original CRISPR GTGGCCGGGCCAGGTGATCC AGG (reversed) Intergenic