ID: 1019301204

View in Genome Browser
Species Human (GRCh38)
Location 7:304378-304400
Sequence TGGATGAAGGTGGCCGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019301204_1019301219 24 Left 1019301204 7:304378-304400 CCTGGCCCGGCCACCTTCATCCA No data
Right 1019301219 7:304425-304447 CACAGGCACCCTGGGGTGAAGGG No data
1019301204_1019301216 17 Left 1019301204 7:304378-304400 CCTGGCCCGGCCACCTTCATCCA No data
Right 1019301216 7:304418-304440 CGTCCTGCACAGGCACCCTGGGG No data
1019301204_1019301220 25 Left 1019301204 7:304378-304400 CCTGGCCCGGCCACCTTCATCCA No data
Right 1019301220 7:304426-304448 ACAGGCACCCTGGGGTGAAGGGG No data
1019301204_1019301213 15 Left 1019301204 7:304378-304400 CCTGGCCCGGCCACCTTCATCCA No data
Right 1019301213 7:304416-304438 CCCGTCCTGCACAGGCACCCTGG No data
1019301204_1019301211 7 Left 1019301204 7:304378-304400 CCTGGCCCGGCCACCTTCATCCA No data
Right 1019301211 7:304408-304430 GTTGAAGTCCCGTCCTGCACAGG No data
1019301204_1019301221 26 Left 1019301204 7:304378-304400 CCTGGCCCGGCCACCTTCATCCA No data
Right 1019301221 7:304427-304449 CAGGCACCCTGGGGTGAAGGGGG No data
1019301204_1019301215 16 Left 1019301204 7:304378-304400 CCTGGCCCGGCCACCTTCATCCA No data
Right 1019301215 7:304417-304439 CCGTCCTGCACAGGCACCCTGGG No data
1019301204_1019301218 23 Left 1019301204 7:304378-304400 CCTGGCCCGGCCACCTTCATCCA No data
Right 1019301218 7:304424-304446 GCACAGGCACCCTGGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019301204 Original CRISPR TGGATGAAGGTGGCCGGGCC AGG (reversed) Intergenic