ID: 1019301209

View in Genome Browser
Species Human (GRCh38)
Location 7:304391-304413
Sequence TTCAACTCACACCTGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019301209_1019301223 19 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301223 7:304433-304455 CCCTGGGGTGAAGGGGGCGCTGG No data
1019301209_1019301226 21 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301226 7:304435-304457 CTGGGGTGAAGGGGGCGCTGGGG No data
1019301209_1019301211 -6 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301211 7:304408-304430 GTTGAAGTCCCGTCCTGCACAGG No data
1019301209_1019301213 2 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301213 7:304416-304438 CCCGTCCTGCACAGGCACCCTGG No data
1019301209_1019301221 13 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301221 7:304427-304449 CAGGCACCCTGGGGTGAAGGGGG No data
1019301209_1019301225 20 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301225 7:304434-304456 CCTGGGGTGAAGGGGGCGCTGGG No data
1019301209_1019301219 11 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301219 7:304425-304447 CACAGGCACCCTGGGGTGAAGGG No data
1019301209_1019301216 4 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301216 7:304418-304440 CGTCCTGCACAGGCACCCTGGGG No data
1019301209_1019301220 12 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301220 7:304426-304448 ACAGGCACCCTGGGGTGAAGGGG No data
1019301209_1019301218 10 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301218 7:304424-304446 GCACAGGCACCCTGGGGTGAAGG No data
1019301209_1019301215 3 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301215 7:304417-304439 CCGTCCTGCACAGGCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019301209 Original CRISPR TTCAACTCACACCTGGATGA AGG (reversed) Intergenic