ID: 1019301219

View in Genome Browser
Species Human (GRCh38)
Location 7:304425-304447
Sequence CACAGGCACCCTGGGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019301206_1019301219 19 Left 1019301206 7:304383-304405 CCCGGCCACCTTCATCCAGGTGT No data
Right 1019301219 7:304425-304447 CACAGGCACCCTGGGGTGAAGGG No data
1019301209_1019301219 11 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301219 7:304425-304447 CACAGGCACCCTGGGGTGAAGGG No data
1019301204_1019301219 24 Left 1019301204 7:304378-304400 CCTGGCCCGGCCACCTTCATCCA No data
Right 1019301219 7:304425-304447 CACAGGCACCCTGGGGTGAAGGG No data
1019301210_1019301219 4 Left 1019301210 7:304398-304420 CCAGGTGTGAGTTGAAGTCCCGT No data
Right 1019301219 7:304425-304447 CACAGGCACCCTGGGGTGAAGGG No data
1019301208_1019301219 14 Left 1019301208 7:304388-304410 CCACCTTCATCCAGGTGTGAGTT No data
Right 1019301219 7:304425-304447 CACAGGCACCCTGGGGTGAAGGG No data
1019301207_1019301219 18 Left 1019301207 7:304384-304406 CCGGCCACCTTCATCCAGGTGTG No data
Right 1019301219 7:304425-304447 CACAGGCACCCTGGGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019301219 Original CRISPR CACAGGCACCCTGGGGTGAA GGG Intergenic