ID: 1019301221

View in Genome Browser
Species Human (GRCh38)
Location 7:304427-304449
Sequence CAGGCACCCTGGGGTGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019301208_1019301221 16 Left 1019301208 7:304388-304410 CCACCTTCATCCAGGTGTGAGTT No data
Right 1019301221 7:304427-304449 CAGGCACCCTGGGGTGAAGGGGG No data
1019301206_1019301221 21 Left 1019301206 7:304383-304405 CCCGGCCACCTTCATCCAGGTGT No data
Right 1019301221 7:304427-304449 CAGGCACCCTGGGGTGAAGGGGG No data
1019301210_1019301221 6 Left 1019301210 7:304398-304420 CCAGGTGTGAGTTGAAGTCCCGT No data
Right 1019301221 7:304427-304449 CAGGCACCCTGGGGTGAAGGGGG No data
1019301204_1019301221 26 Left 1019301204 7:304378-304400 CCTGGCCCGGCCACCTTCATCCA No data
Right 1019301221 7:304427-304449 CAGGCACCCTGGGGTGAAGGGGG No data
1019301209_1019301221 13 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301221 7:304427-304449 CAGGCACCCTGGGGTGAAGGGGG No data
1019301207_1019301221 20 Left 1019301207 7:304384-304406 CCGGCCACCTTCATCCAGGTGTG No data
Right 1019301221 7:304427-304449 CAGGCACCCTGGGGTGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019301221 Original CRISPR CAGGCACCCTGGGGTGAAGG GGG Intergenic