ID: 1019301225

View in Genome Browser
Species Human (GRCh38)
Location 7:304434-304456
Sequence CCTGGGGTGAAGGGGGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019301208_1019301225 23 Left 1019301208 7:304388-304410 CCACCTTCATCCAGGTGTGAGTT No data
Right 1019301225 7:304434-304456 CCTGGGGTGAAGGGGGCGCTGGG No data
1019301214_1019301225 -6 Left 1019301214 7:304417-304439 CCGTCCTGCACAGGCACCCTGGG No data
Right 1019301225 7:304434-304456 CCTGGGGTGAAGGGGGCGCTGGG No data
1019301217_1019301225 -10 Left 1019301217 7:304421-304443 CCTGCACAGGCACCCTGGGGTGA No data
Right 1019301225 7:304434-304456 CCTGGGGTGAAGGGGGCGCTGGG No data
1019301210_1019301225 13 Left 1019301210 7:304398-304420 CCAGGTGTGAGTTGAAGTCCCGT No data
Right 1019301225 7:304434-304456 CCTGGGGTGAAGGGGGCGCTGGG No data
1019301207_1019301225 27 Left 1019301207 7:304384-304406 CCGGCCACCTTCATCCAGGTGTG No data
Right 1019301225 7:304434-304456 CCTGGGGTGAAGGGGGCGCTGGG No data
1019301209_1019301225 20 Left 1019301209 7:304391-304413 CCTTCATCCAGGTGTGAGTTGAA No data
Right 1019301225 7:304434-304456 CCTGGGGTGAAGGGGGCGCTGGG No data
1019301212_1019301225 -5 Left 1019301212 7:304416-304438 CCCGTCCTGCACAGGCACCCTGG No data
Right 1019301225 7:304434-304456 CCTGGGGTGAAGGGGGCGCTGGG No data
1019301206_1019301225 28 Left 1019301206 7:304383-304405 CCCGGCCACCTTCATCCAGGTGT No data
Right 1019301225 7:304434-304456 CCTGGGGTGAAGGGGGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019301225 Original CRISPR CCTGGGGTGAAGGGGGCGCT GGG Intergenic