ID: 1019301348

View in Genome Browser
Species Human (GRCh38)
Location 7:305645-305667
Sequence CACGGAACCACGGCAGGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019301341_1019301348 -1 Left 1019301341 7:305623-305645 CCGTGCGCCAGGCACCCGCGCTC No data
Right 1019301348 7:305645-305667 CACGGAACCACGGCAGGACGTGG No data
1019301343_1019301348 -8 Left 1019301343 7:305630-305652 CCAGGCACCCGCGCTCACGGAAC No data
Right 1019301348 7:305645-305667 CACGGAACCACGGCAGGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019301348 Original CRISPR CACGGAACCACGGCAGGACG TGG Intergenic
No off target data available for this crispr