ID: 1019303443

View in Genome Browser
Species Human (GRCh38)
Location 7:321336-321358
Sequence CCACAGGTGTGATGGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019303443_1019303452 4 Left 1019303443 7:321336-321358 CCCTGTTCCCATCACACCTGTGG No data
Right 1019303452 7:321363-321385 CTTGGCTTGACACCTGGCAGTGG No data
1019303443_1019303453 5 Left 1019303443 7:321336-321358 CCCTGTTCCCATCACACCTGTGG No data
Right 1019303453 7:321364-321386 TTGGCTTGACACCTGGCAGTGGG No data
1019303443_1019303455 20 Left 1019303443 7:321336-321358 CCCTGTTCCCATCACACCTGTGG No data
Right 1019303455 7:321379-321401 GCAGTGGGCCATAACCTCCCTGG No data
1019303443_1019303451 -2 Left 1019303443 7:321336-321358 CCCTGTTCCCATCACACCTGTGG No data
Right 1019303451 7:321357-321379 GGGTGACTTGGCTTGACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019303443 Original CRISPR CCACAGGTGTGATGGGAACA GGG (reversed) Intergenic
No off target data available for this crispr