ID: 1019303453

View in Genome Browser
Species Human (GRCh38)
Location 7:321364-321386
Sequence TTGGCTTGACACCTGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019303443_1019303453 5 Left 1019303443 7:321336-321358 CCCTGTTCCCATCACACCTGTGG No data
Right 1019303453 7:321364-321386 TTGGCTTGACACCTGGCAGTGGG No data
1019303445_1019303453 4 Left 1019303445 7:321337-321359 CCTGTTCCCATCACACCTGTGGG No data
Right 1019303453 7:321364-321386 TTGGCTTGACACCTGGCAGTGGG No data
1019303442_1019303453 26 Left 1019303442 7:321315-321337 CCATTTAAAAACGTCACTTGGCC No data
Right 1019303453 7:321364-321386 TTGGCTTGACACCTGGCAGTGGG No data
1019303447_1019303453 -2 Left 1019303447 7:321343-321365 CCCATCACACCTGTGGGTGACTT No data
Right 1019303453 7:321364-321386 TTGGCTTGACACCTGGCAGTGGG No data
1019303448_1019303453 -3 Left 1019303448 7:321344-321366 CCATCACACCTGTGGGTGACTTG No data
Right 1019303453 7:321364-321386 TTGGCTTGACACCTGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019303453 Original CRISPR TTGGCTTGACACCTGGCAGT GGG Intergenic
No off target data available for this crispr