ID: 1019303455

View in Genome Browser
Species Human (GRCh38)
Location 7:321379-321401
Sequence GCAGTGGGCCATAACCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019303447_1019303455 13 Left 1019303447 7:321343-321365 CCCATCACACCTGTGGGTGACTT No data
Right 1019303455 7:321379-321401 GCAGTGGGCCATAACCTCCCTGG No data
1019303443_1019303455 20 Left 1019303443 7:321336-321358 CCCTGTTCCCATCACACCTGTGG No data
Right 1019303455 7:321379-321401 GCAGTGGGCCATAACCTCCCTGG No data
1019303448_1019303455 12 Left 1019303448 7:321344-321366 CCATCACACCTGTGGGTGACTTG No data
Right 1019303455 7:321379-321401 GCAGTGGGCCATAACCTCCCTGG No data
1019303445_1019303455 19 Left 1019303445 7:321337-321359 CCTGTTCCCATCACACCTGTGGG No data
Right 1019303455 7:321379-321401 GCAGTGGGCCATAACCTCCCTGG No data
1019303450_1019303455 4 Left 1019303450 7:321352-321374 CCTGTGGGTGACTTGGCTTGACA No data
Right 1019303455 7:321379-321401 GCAGTGGGCCATAACCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019303455 Original CRISPR GCAGTGGGCCATAACCTCCC TGG Intergenic
No off target data available for this crispr