ID: 1019303511

View in Genome Browser
Species Human (GRCh38)
Location 7:321631-321653
Sequence GGGCGATCCCAGAGCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019303511_1019303517 1 Left 1019303511 7:321631-321653 CCCACAGAGCTCTGGGATCGCCC No data
Right 1019303517 7:321655-321677 CCTCCACCTGCCCCAGGCCTCGG No data
1019303511_1019303513 -5 Left 1019303511 7:321631-321653 CCCACAGAGCTCTGGGATCGCCC No data
Right 1019303513 7:321649-321671 CGCCCTCCTCCACCTGCCCCAGG No data
1019303511_1019303521 11 Left 1019303511 7:321631-321653 CCCACAGAGCTCTGGGATCGCCC No data
Right 1019303521 7:321665-321687 CCCCAGGCCTCGGCAGCAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019303511 Original CRISPR GGGCGATCCCAGAGCTCTGT GGG (reversed) Intergenic
No off target data available for this crispr