ID: 1019305892

View in Genome Browser
Species Human (GRCh38)
Location 7:335604-335626
Sequence CAAACCTGCAGCCAGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019305892_1019305898 -7 Left 1019305892 7:335604-335626 CCCAGGCCCTGGCTGCAGGTTTG No data
Right 1019305898 7:335620-335642 AGGTTTGCGTGGCCCACCAAGGG No data
1019305892_1019305904 17 Left 1019305892 7:335604-335626 CCCAGGCCCTGGCTGCAGGTTTG No data
Right 1019305904 7:335644-335666 CACAGGTGCACAGAAGGCACTGG No data
1019305892_1019305899 0 Left 1019305892 7:335604-335626 CCCAGGCCCTGGCTGCAGGTTTG No data
Right 1019305899 7:335627-335649 CGTGGCCCACCAAGGGTCACAGG No data
1019305892_1019305906 23 Left 1019305892 7:335604-335626 CCCAGGCCCTGGCTGCAGGTTTG No data
Right 1019305906 7:335650-335672 TGCACAGAAGGCACTGGGCACGG No data
1019305892_1019305905 18 Left 1019305892 7:335604-335626 CCCAGGCCCTGGCTGCAGGTTTG No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data
1019305892_1019305903 11 Left 1019305892 7:335604-335626 CCCAGGCCCTGGCTGCAGGTTTG No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data
1019305892_1019305897 -8 Left 1019305892 7:335604-335626 CCCAGGCCCTGGCTGCAGGTTTG No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019305892 Original CRISPR CAAACCTGCAGCCAGGGCCT GGG (reversed) Intergenic
No off target data available for this crispr