ID: 1019305894

View in Genome Browser
Species Human (GRCh38)
Location 7:335609-335631
Sequence GCCCTGGCTGCAGGTTTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019305883_1019305894 2 Left 1019305883 7:335584-335606 CCTCATCCCCTCCAGAGGTCCCC No data
Right 1019305894 7:335609-335631 GCCCTGGCTGCAGGTTTGCGTGG No data
1019305887_1019305894 -6 Left 1019305887 7:335592-335614 CCTCCAGAGGTCCCCAGGCCCTG No data
Right 1019305894 7:335609-335631 GCCCTGGCTGCAGGTTTGCGTGG No data
1019305889_1019305894 -9 Left 1019305889 7:335595-335617 CCAGAGGTCCCCAGGCCCTGGCT No data
Right 1019305894 7:335609-335631 GCCCTGGCTGCAGGTTTGCGTGG No data
1019305885_1019305894 -4 Left 1019305885 7:335590-335612 CCCCTCCAGAGGTCCCCAGGCCC No data
Right 1019305894 7:335609-335631 GCCCTGGCTGCAGGTTTGCGTGG No data
1019305886_1019305894 -5 Left 1019305886 7:335591-335613 CCCTCCAGAGGTCCCCAGGCCCT No data
Right 1019305894 7:335609-335631 GCCCTGGCTGCAGGTTTGCGTGG No data
1019305882_1019305894 6 Left 1019305882 7:335580-335602 CCATCCTCATCCCCTCCAGAGGT No data
Right 1019305894 7:335609-335631 GCCCTGGCTGCAGGTTTGCGTGG No data
1019305880_1019305894 18 Left 1019305880 7:335568-335590 CCTCTTGCTGTTCCATCCTCATC No data
Right 1019305894 7:335609-335631 GCCCTGGCTGCAGGTTTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019305894 Original CRISPR GCCCTGGCTGCAGGTTTGCG TGG Intergenic
No off target data available for this crispr