ID: 1019305896

View in Genome Browser
Species Human (GRCh38)
Location 7:335611-335633
Sequence GGCCACGCAAACCTGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019305896_1019305907 24 Left 1019305896 7:335611-335633 CCTGGCTGCAGGTTTGCGTGGCC No data
Right 1019305907 7:335658-335680 AGGCACTGGGCACGGTGCAGTGG No data
1019305896_1019305904 10 Left 1019305896 7:335611-335633 CCTGGCTGCAGGTTTGCGTGGCC No data
Right 1019305904 7:335644-335666 CACAGGTGCACAGAAGGCACTGG No data
1019305896_1019305903 4 Left 1019305896 7:335611-335633 CCTGGCTGCAGGTTTGCGTGGCC No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data
1019305896_1019305906 16 Left 1019305896 7:335611-335633 CCTGGCTGCAGGTTTGCGTGGCC No data
Right 1019305906 7:335650-335672 TGCACAGAAGGCACTGGGCACGG No data
1019305896_1019305905 11 Left 1019305896 7:335611-335633 CCTGGCTGCAGGTTTGCGTGGCC No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data
1019305896_1019305899 -7 Left 1019305896 7:335611-335633 CCTGGCTGCAGGTTTGCGTGGCC No data
Right 1019305899 7:335627-335649 CGTGGCCCACCAAGGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019305896 Original CRISPR GGCCACGCAAACCTGCAGCC AGG (reversed) Intergenic
No off target data available for this crispr