ID: 1019305897

View in Genome Browser
Species Human (GRCh38)
Location 7:335619-335641
Sequence CAGGTTTGCGTGGCCCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019305891_1019305897 -7 Left 1019305891 7:335603-335625 CCCCAGGCCCTGGCTGCAGGTTT No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data
1019305886_1019305897 5 Left 1019305886 7:335591-335613 CCCTCCAGAGGTCCCCAGGCCCT No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data
1019305889_1019305897 1 Left 1019305889 7:335595-335617 CCAGAGGTCCCCAGGCCCTGGCT No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data
1019305885_1019305897 6 Left 1019305885 7:335590-335612 CCCCTCCAGAGGTCCCCAGGCCC No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data
1019305893_1019305897 -9 Left 1019305893 7:335605-335627 CCAGGCCCTGGCTGCAGGTTTGC No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data
1019305887_1019305897 4 Left 1019305887 7:335592-335614 CCTCCAGAGGTCCCCAGGCCCTG No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data
1019305892_1019305897 -8 Left 1019305892 7:335604-335626 CCCAGGCCCTGGCTGCAGGTTTG No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data
1019305880_1019305897 28 Left 1019305880 7:335568-335590 CCTCTTGCTGTTCCATCCTCATC No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data
1019305882_1019305897 16 Left 1019305882 7:335580-335602 CCATCCTCATCCCCTCCAGAGGT No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data
1019305883_1019305897 12 Left 1019305883 7:335584-335606 CCTCATCCCCTCCAGAGGTCCCC No data
Right 1019305897 7:335619-335641 CAGGTTTGCGTGGCCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019305897 Original CRISPR CAGGTTTGCGTGGCCCACCA AGG Intergenic
No off target data available for this crispr