ID: 1019305900

View in Genome Browser
Species Human (GRCh38)
Location 7:335632-335654
Sequence GTGCACCTGTGACCCTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019305900_1019305907 3 Left 1019305900 7:335632-335654 CCCACCAAGGGTCACAGGTGCAC No data
Right 1019305907 7:335658-335680 AGGCACTGGGCACGGTGCAGTGG No data
1019305900_1019305912 30 Left 1019305900 7:335632-335654 CCCACCAAGGGTCACAGGTGCAC No data
Right 1019305912 7:335685-335707 CACATTCCCCTGGGGTGCCCTGG No data
1019305900_1019305908 20 Left 1019305900 7:335632-335654 CCCACCAAGGGTCACAGGTGCAC No data
Right 1019305908 7:335675-335697 CAGTGGCCATCACATTCCCCTGG No data
1019305900_1019305909 21 Left 1019305900 7:335632-335654 CCCACCAAGGGTCACAGGTGCAC No data
Right 1019305909 7:335676-335698 AGTGGCCATCACATTCCCCTGGG No data
1019305900_1019305905 -10 Left 1019305900 7:335632-335654 CCCACCAAGGGTCACAGGTGCAC No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data
1019305900_1019305910 22 Left 1019305900 7:335632-335654 CCCACCAAGGGTCACAGGTGCAC No data
Right 1019305910 7:335677-335699 GTGGCCATCACATTCCCCTGGGG No data
1019305900_1019305906 -5 Left 1019305900 7:335632-335654 CCCACCAAGGGTCACAGGTGCAC No data
Right 1019305906 7:335650-335672 TGCACAGAAGGCACTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019305900 Original CRISPR GTGCACCTGTGACCCTTGGT GGG (reversed) Intergenic
No off target data available for this crispr