ID: 1019305903

View in Genome Browser
Species Human (GRCh38)
Location 7:335638-335660
Sequence AAGGGTCACAGGTGCACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019305896_1019305903 4 Left 1019305896 7:335611-335633 CCTGGCTGCAGGTTTGCGTGGCC No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data
1019305891_1019305903 12 Left 1019305891 7:335603-335625 CCCCAGGCCCTGGCTGCAGGTTT No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data
1019305885_1019305903 25 Left 1019305885 7:335590-335612 CCCCTCCAGAGGTCCCCAGGCCC No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data
1019305887_1019305903 23 Left 1019305887 7:335592-335614 CCTCCAGAGGTCCCCAGGCCCTG No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data
1019305893_1019305903 10 Left 1019305893 7:335605-335627 CCAGGCCCTGGCTGCAGGTTTGC No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data
1019305889_1019305903 20 Left 1019305889 7:335595-335617 CCAGAGGTCCCCAGGCCCTGGCT No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data
1019305886_1019305903 24 Left 1019305886 7:335591-335613 CCCTCCAGAGGTCCCCAGGCCCT No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data
1019305895_1019305903 5 Left 1019305895 7:335610-335632 CCCTGGCTGCAGGTTTGCGTGGC No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data
1019305892_1019305903 11 Left 1019305892 7:335604-335626 CCCAGGCCCTGGCTGCAGGTTTG No data
Right 1019305903 7:335638-335660 AAGGGTCACAGGTGCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019305903 Original CRISPR AAGGGTCACAGGTGCACAGA AGG Intergenic
No off target data available for this crispr