ID: 1019305905

View in Genome Browser
Species Human (GRCh38)
Location 7:335645-335667
Sequence ACAGGTGCACAGAAGGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019305900_1019305905 -10 Left 1019305900 7:335632-335654 CCCACCAAGGGTCACAGGTGCAC No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data
1019305887_1019305905 30 Left 1019305887 7:335592-335614 CCTCCAGAGGTCCCCAGGCCCTG No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data
1019305891_1019305905 19 Left 1019305891 7:335603-335625 CCCCAGGCCCTGGCTGCAGGTTT No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data
1019305896_1019305905 11 Left 1019305896 7:335611-335633 CCTGGCTGCAGGTTTGCGTGGCC No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data
1019305893_1019305905 17 Left 1019305893 7:335605-335627 CCAGGCCCTGGCTGCAGGTTTGC No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data
1019305895_1019305905 12 Left 1019305895 7:335610-335632 CCCTGGCTGCAGGTTTGCGTGGC No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data
1019305889_1019305905 27 Left 1019305889 7:335595-335617 CCAGAGGTCCCCAGGCCCTGGCT No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data
1019305892_1019305905 18 Left 1019305892 7:335604-335626 CCCAGGCCCTGGCTGCAGGTTTG No data
Right 1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019305905 Original CRISPR ACAGGTGCACAGAAGGCACT GGG Intergenic
No off target data available for this crispr