ID: 1019305948

View in Genome Browser
Species Human (GRCh38)
Location 7:335833-335855
Sequence CACAGAAGTGGGGCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019305948_1019305961 13 Left 1019305948 7:335833-335855 CCCCTCCTGGCCCCACTTCTGTG No data
Right 1019305961 7:335869-335891 CCAGGTGAGCATCCTACACCTGG No data
1019305948_1019305955 -5 Left 1019305948 7:335833-335855 CCCCTCCTGGCCCCACTTCTGTG No data
Right 1019305955 7:335851-335873 CTGTGCCCCTAAGCATGCCCAGG No data
1019305948_1019305962 20 Left 1019305948 7:335833-335855 CCCCTCCTGGCCCCACTTCTGTG No data
Right 1019305962 7:335876-335898 AGCATCCTACACCTGGCCACTGG No data
1019305948_1019305964 22 Left 1019305948 7:335833-335855 CCCCTCCTGGCCCCACTTCTGTG No data
Right 1019305964 7:335878-335900 CATCCTACACCTGGCCACTGGGG No data
1019305948_1019305963 21 Left 1019305948 7:335833-335855 CCCCTCCTGGCCCCACTTCTGTG No data
Right 1019305963 7:335877-335899 GCATCCTACACCTGGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019305948 Original CRISPR CACAGAAGTGGGGCCAGGAG GGG (reversed) Intergenic
No off target data available for this crispr