ID: 1019306993

View in Genome Browser
Species Human (GRCh38)
Location 7:340328-340350
Sequence CAGGACAGCCCCAAAGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019306993_1019306998 23 Left 1019306993 7:340328-340350 CCTGGCACTTTGGGGCTGTCCTG No data
Right 1019306998 7:340374-340396 CCCCCTATGCGAAGCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019306993 Original CRISPR CAGGACAGCCCCAAAGTGCC AGG (reversed) Intergenic
No off target data available for this crispr