ID: 1019307083

View in Genome Browser
Species Human (GRCh38)
Location 7:340788-340810
Sequence CACCGGAGGCGGGAGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019307083_1019307095 11 Left 1019307083 7:340788-340810 CCAGGCCCCTCCCGCCTCCGGTG No data
Right 1019307095 7:340822-340844 CCTTGCCACTCCTTGTCTTCTGG No data
1019307083_1019307098 24 Left 1019307083 7:340788-340810 CCAGGCCCCTCCCGCCTCCGGTG No data
Right 1019307098 7:340835-340857 TGTCTTCTGGCCATGCCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019307083 Original CRISPR CACCGGAGGCGGGAGGGGCC TGG (reversed) Intergenic
No off target data available for this crispr