ID: 1019307662

View in Genome Browser
Species Human (GRCh38)
Location 7:343534-343556
Sequence GTCCTCTGGTCTCACGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019307662_1019307666 -7 Left 1019307662 7:343534-343556 CCAGCACCGTGAGACCAGAGGAC No data
Right 1019307666 7:343550-343572 AGAGGACCCAGCAGTGAAGGAGG No data
1019307662_1019307664 -10 Left 1019307662 7:343534-343556 CCAGCACCGTGAGACCAGAGGAC No data
Right 1019307664 7:343547-343569 ACCAGAGGACCCAGCAGTGAAGG No data
1019307662_1019307671 23 Left 1019307662 7:343534-343556 CCAGCACCGTGAGACCAGAGGAC No data
Right 1019307671 7:343580-343602 TGTCCCCGAGCTGCACACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019307662 Original CRISPR GTCCTCTGGTCTCACGGTGC TGG (reversed) Intergenic
No off target data available for this crispr