ID: 1019308995

View in Genome Browser
Species Human (GRCh38)
Location 7:349860-349882
Sequence CAGGGCCAGCCTGCATCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019308995_1019309003 0 Left 1019308995 7:349860-349882 CCCCTGGATGCAGGCTGGCCCTG No data
Right 1019309003 7:349883-349905 GATGGACGGTCCTCCTCTGCAGG No data
1019308995_1019309007 19 Left 1019308995 7:349860-349882 CCCCTGGATGCAGGCTGGCCCTG No data
Right 1019309007 7:349902-349924 CAGGCCGTGTTTGGTGAGTTCGG No data
1019308995_1019309005 10 Left 1019308995 7:349860-349882 CCCCTGGATGCAGGCTGGCCCTG No data
Right 1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019308995 Original CRISPR CAGGGCCAGCCTGCATCCAG GGG (reversed) Intergenic
No off target data available for this crispr