ID: 1019309001

View in Genome Browser
Species Human (GRCh38)
Location 7:349878-349900
Sequence AGAGGAGGACCGTCCATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019309001_1019309005 -8 Left 1019309001 7:349878-349900 CCCTGGATGGACGGTCCTCCTCT No data
Right 1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG No data
1019309001_1019309007 1 Left 1019309001 7:349878-349900 CCCTGGATGGACGGTCCTCCTCT No data
Right 1019309007 7:349902-349924 CAGGCCGTGTTTGGTGAGTTCGG No data
1019309001_1019309009 26 Left 1019309001 7:349878-349900 CCCTGGATGGACGGTCCTCCTCT No data
Right 1019309009 7:349927-349949 CACATGCATCTCGTCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019309001 Original CRISPR AGAGGAGGACCGTCCATCCA GGG (reversed) Intergenic
No off target data available for this crispr