ID: 1019309002

View in Genome Browser
Species Human (GRCh38)
Location 7:349879-349901
Sequence CAGAGGAGGACCGTCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019309002_1019309007 0 Left 1019309002 7:349879-349901 CCTGGATGGACGGTCCTCCTCTG No data
Right 1019309007 7:349902-349924 CAGGCCGTGTTTGGTGAGTTCGG No data
1019309002_1019309009 25 Left 1019309002 7:349879-349901 CCTGGATGGACGGTCCTCCTCTG No data
Right 1019309009 7:349927-349949 CACATGCATCTCGTCCTCCATGG No data
1019309002_1019309005 -9 Left 1019309002 7:349879-349901 CCTGGATGGACGGTCCTCCTCTG No data
Right 1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019309002 Original CRISPR CAGAGGAGGACCGTCCATCC AGG (reversed) Intergenic
No off target data available for this crispr