ID: 1019309005

View in Genome Browser
Species Human (GRCh38)
Location 7:349893-349915
Sequence CCTCCTCTGCAGGCCGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019308996_1019309005 9 Left 1019308996 7:349861-349883 CCCTGGATGCAGGCTGGCCCTGG No data
Right 1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG No data
1019309001_1019309005 -8 Left 1019309001 7:349878-349900 CCCTGGATGGACGGTCCTCCTCT No data
Right 1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG No data
1019308995_1019309005 10 Left 1019308995 7:349860-349882 CCCCTGGATGCAGGCTGGCCCTG No data
Right 1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG No data
1019308998_1019309005 8 Left 1019308998 7:349862-349884 CCTGGATGCAGGCTGGCCCTGGA No data
Right 1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG No data
1019309002_1019309005 -9 Left 1019309002 7:349879-349901 CCTGGATGGACGGTCCTCCTCTG No data
Right 1019309005 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019309005 Original CRISPR CCTCCTCTGCAGGCCGTGTT TGG Intergenic
No off target data available for this crispr