ID: 1019309009

View in Genome Browser
Species Human (GRCh38)
Location 7:349927-349949
Sequence CACATGCATCTCGTCCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019309008_1019309009 -2 Left 1019309008 7:349906-349928 CCGTGTTTGGTGAGTTCGGTTCA No data
Right 1019309009 7:349927-349949 CACATGCATCTCGTCCTCCATGG No data
1019309002_1019309009 25 Left 1019309002 7:349879-349901 CCTGGATGGACGGTCCTCCTCTG No data
Right 1019309009 7:349927-349949 CACATGCATCTCGTCCTCCATGG No data
1019309004_1019309009 11 Left 1019309004 7:349893-349915 CCTCCTCTGCAGGCCGTGTTTGG No data
Right 1019309009 7:349927-349949 CACATGCATCTCGTCCTCCATGG No data
1019309006_1019309009 8 Left 1019309006 7:349896-349918 CCTCTGCAGGCCGTGTTTGGTGA No data
Right 1019309009 7:349927-349949 CACATGCATCTCGTCCTCCATGG No data
1019309001_1019309009 26 Left 1019309001 7:349878-349900 CCCTGGATGGACGGTCCTCCTCT No data
Right 1019309009 7:349927-349949 CACATGCATCTCGTCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019309009 Original CRISPR CACATGCATCTCGTCCTCCA TGG Intergenic
No off target data available for this crispr