ID: 1019311585

View in Genome Browser
Species Human (GRCh38)
Location 7:364437-364459
Sequence CAGTGGTGACAGTGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019311585_1019311595 1 Left 1019311585 7:364437-364459 CCCCCTCCCCACTGTCACCACTG No data
Right 1019311595 7:364461-364483 TGGATGTTGGCTGTTCTCTCTGG No data
1019311585_1019311596 30 Left 1019311585 7:364437-364459 CCCCCTCCCCACTGTCACCACTG No data
Right 1019311596 7:364490-364512 TTCCTTGACAAGCCTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019311585 Original CRISPR CAGTGGTGACAGTGGGGAGG GGG (reversed) Intergenic
No off target data available for this crispr