ID: 1019311686

View in Genome Browser
Species Human (GRCh38)
Location 7:365005-365027
Sequence CTGCAGAAACAGAAAGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019311686_1019311692 15 Left 1019311686 7:365005-365027 CCCTGCACTTTCTGTTTCTGCAG No data
Right 1019311692 7:365043-365065 CCTTCGCTTCTTTACTTACTGGG No data
1019311686_1019311690 14 Left 1019311686 7:365005-365027 CCCTGCACTTTCTGTTTCTGCAG No data
Right 1019311690 7:365042-365064 TCCTTCGCTTCTTTACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019311686 Original CRISPR CTGCAGAAACAGAAAGTGCA GGG (reversed) Intergenic
No off target data available for this crispr