ID: 1019315998

View in Genome Browser
Species Human (GRCh38)
Location 7:387194-387216
Sequence CCGCATCCTGTACTTGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019315998_1019316009 19 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316009 7:387236-387258 GACGGGACCGTGAGCGGCAGAGG No data
1019315998_1019316006 1 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316006 7:387218-387240 GTTAGAGTGGGCTGGGGCGACGG No data
1019315998_1019316003 -7 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316003 7:387210-387232 GATGCGGCGTTAGAGTGGGCTGG No data
1019315998_1019316005 -5 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316005 7:387212-387234 TGCGGCGTTAGAGTGGGCTGGGG No data
1019315998_1019316007 2 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316007 7:387219-387241 TTAGAGTGGGCTGGGGCGACGGG No data
1019315998_1019316004 -6 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316004 7:387211-387233 ATGCGGCGTTAGAGTGGGCTGGG No data
1019315998_1019316008 13 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316008 7:387230-387252 TGGGGCGACGGGACCGTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019315998 Original CRISPR CCGCATCCTGTACTTGGCCG TGG (reversed) Intergenic
No off target data available for this crispr