ID: 1019316003

View in Genome Browser
Species Human (GRCh38)
Location 7:387210-387232
Sequence GATGCGGCGTTAGAGTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019315998_1019316003 -7 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316003 7:387210-387232 GATGCGGCGTTAGAGTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019316003 Original CRISPR GATGCGGCGTTAGAGTGGGC TGG Intergenic
No off target data available for this crispr