ID: 1019316004

View in Genome Browser
Species Human (GRCh38)
Location 7:387211-387233
Sequence ATGCGGCGTTAGAGTGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019315998_1019316004 -6 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316004 7:387211-387233 ATGCGGCGTTAGAGTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019316004 Original CRISPR ATGCGGCGTTAGAGTGGGCT GGG Intergenic
No off target data available for this crispr