ID: 1019316005

View in Genome Browser
Species Human (GRCh38)
Location 7:387212-387234
Sequence TGCGGCGTTAGAGTGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019315998_1019316005 -5 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316005 7:387212-387234 TGCGGCGTTAGAGTGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019316005 Original CRISPR TGCGGCGTTAGAGTGGGCTG GGG Intergenic
No off target data available for this crispr