ID: 1019316007

View in Genome Browser
Species Human (GRCh38)
Location 7:387219-387241
Sequence TTAGAGTGGGCTGGGGCGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019315998_1019316007 2 Left 1019315998 7:387194-387216 CCACGGCCAAGTACAGGATGCGG No data
Right 1019316007 7:387219-387241 TTAGAGTGGGCTGGGGCGACGGG No data
1019316000_1019316007 -4 Left 1019316000 7:387200-387222 CCAAGTACAGGATGCGGCGTTAG No data
Right 1019316007 7:387219-387241 TTAGAGTGGGCTGGGGCGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019316007 Original CRISPR TTAGAGTGGGCTGGGGCGAC GGG Intergenic
No off target data available for this crispr